View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_high_7 (Length: 414)
Name: NF0710_high_7
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0710_high_7 |
 |  |
|
[»] scaffold0060 (2 HSPs) |
 |  |  |
|
[»] scaffold0007 (1 HSPs) |
 |  |  |
|
[»] scaffold0160 (1 HSPs) |
 |  |  |
|
[»] scaffold0056 (2 HSPs) |
 |  |  |
|
[»] scaffold0005 (1 HSPs) |
 |  |  |
|
[»] scaffold0001 (1 HSPs) |
 |  |  |
|
[»] scaffold0339 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 33)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 324
Target Start/End: Complemental strand, 37126372 - 37126054
Alignment:
Q |
8 |
tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaag |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
37126372 |
tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatatttgtgctgaccggacttgaggctaag |
37126273 |
T |
 |
Q |
108 |
cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccgg |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
37126272 |
cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtattttgctatacagagtttgcggtggaaattccgg |
37126173 |
T |
 |
Q |
208 |
ttgcaggtactttctcttattctcactataatctttcttatgcattatatgatcatt---ggcaaaaatatagttttggtctttgcaaatatgtctcgtt |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| || |||||||||||||| |
|
|
T |
37126172 |
ttgcaggtactttctcttattctcactataatctttcttatgcattatatgatcatttgcagcaaaaatatgattttggtc-ctgaaaatatgtctcgtt |
37126074 |
T |
 |
Q |
305 |
ttgattttagtttttgtaat |
324 |
Q |
|
|
||||||||||| |||||||| |
|
|
T |
37126073 |
ttgattttagtctttgtaat |
37126054 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 37113634 - 37113405
Alignment:
Q |
8 |
tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaag |
107 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||||||||| ||||| || || ||| | || || |||||||| ||||| |||||||||||||||| | |
|
|
T |
37113634 |
tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctagg |
37113535 |
T |
 |
Q |
108 |
cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccgg |
207 |
Q |
|
|
||| | ||||||||||||||||| ||||| |||||||||||||| |||||||||||| |||| |||||||| |||||||| ||||| ||||||||||||| |
|
|
T |
37113534 |
caggaagcaggtccggcagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccgg |
37113435 |
T |
 |
Q |
208 |
ttgcaggtactttctcttattctcactata |
237 |
Q |
|
|
||||||||||||||||||| ||||||||| |
|
|
T |
37113434 |
ttgcaggtactttctcttaccctcactata |
37113405 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 1778561 - 1778614
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
1778561 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
1778614 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 7186006 - 7185954
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
7186006 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
7185954 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 14489075 - 14489023
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
14489075 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
14489023 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 34963666 - 34963614
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
34963666 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
34963614 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 42133156 - 42133104
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
42133156 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42133104 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 4621355 - 4621304
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagt |
4621304 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 8298586 - 8298637
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
8298586 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8298637 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 9496345 - 9496392
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
9496345 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
9496392 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 23360378 - 23360421
Alignment:
Q |
272 |
atatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| |||||||||| ||||||||||||||||||| |||||||| |
|
|
T |
23360378 |
atatggttttggtctctgcaaatatgtctcgttttaattttagt |
23360421 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 25600234 - 25600281
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
25600234 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
25600281 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 35346628 - 35346679
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35346628 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35346679 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 3512262 - 3512216
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
3512262 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3512216 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 7326090 - 7326136
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||| ||||||||| ||||||| |
|
|
T |
7326090 |
aaaatatggttttggtccttgcaaatatgcctcgttttggttttagt |
7326136 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 7420234 - 7420280
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
7420234 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
7420280 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8094483 - 8094529
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| |||| |||||||||||||||||||| ||||||| |
|
|
T |
8094483 |
aaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
8094529 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 8298971 - 8298925
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
8298971 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8298925 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 9175016 - 9175062
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
9175016 |
aaaatatgattttggtccttgcaaatatgtctcgttttggttttagt |
9175062 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 10337123 - 10337169
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
10337123 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10337169 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 11019524 - 11019570
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
11019524 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
11019570 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 11976732 - 11976686
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
11976732 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
11976686 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13154890 - 13154936
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||||||||| || ||||||||||| ||||||||| ||||||| |
|
|
T |
13154890 |
aaaatatagttttgatccttgcaaatatgcctcgttttggttttagt |
13154936 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13232202 - 13232248
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
13232202 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
13232248 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22650468 - 22650514
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
22650468 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
22650514 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 23939544 - 23939598
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||||| ||||||| ||||||||| ||||||||||||||||||| |||||||| |
|
|
T |
23939544 |
attggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagtt |
23939598 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25600593 - 25600547
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
T |
25600593 |
aaaatatagttttggtccctgcaaatatgtcttgttttggttttagt |
25600547 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27117757 - 27117803
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
T |
27117757 |
aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt |
27117803 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32725911 - 32725957
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
32725911 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
32725957 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35097332 - 35097378
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35097332 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35097378 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35346994 - 35346948
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35346994 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35346948 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 263 - 313
Target Start/End: Original strand, 42132862 - 42132912
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
T |
42132862 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 44998265 - 44998213
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| |||||| ||| | |||||||||||||||||| ||||||| |
|
|
T |
44998265 |
ttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt |
44998213 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 37)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 40279331 - 40279276
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| |||||||||||||||||||||||| |||||| ||||||||| |||||| |
|
|
T |
40279331 |
aaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtttatgtaat |
40279276 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 29678028 - 29678074
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
29678028 |
aaaatatagttttggtctttgcaaatatgcctcgttttggttttagt |
29678074 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 20644503 - 20644555
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
T |
20644503 |
ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagt |
20644555 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 19297945 - 19297899
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||| ||||||| |
|
|
T |
19297945 |
aaaatatagttttggtccttgtaaatatgtctcgttttgtttttagt |
19297899 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 263 - 316
Target Start/End: Original strand, 43441268 - 43441321
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
43441268 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
43441321 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 40169656 - 40169604
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
40169656 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
40169604 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 474404 - 474357
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
474404 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
474357 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 4034716 - 4034767
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
4034716 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
4034767 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 26090079 - 26090028
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
26090079 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
26090028 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 29490739 - 29490684
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| | |||||| |
|
|
T |
29490739 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat |
29490684 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 35177259 - 35177314
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| |||||||| |||||||||||||||||||| ||||||||| |||||| |
|
|
T |
35177259 |
aaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgtaat |
35177314 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 36672967 - 36673022
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| |||||||||| ||||||||||||| |||||| ||||||| | |||||| |
|
|
T |
36672967 |
aaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaat |
36673022 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 45521832 - 45521785
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||| |||||||||||||||| |||||||| |||||||| |
|
|
T |
45521832 |
aaaatatggttttagtctttgcaaatatgtttcgttttggttttagtt |
45521785 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 474048 - 474094
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
474048 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
474094 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 863648 - 863602
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
T |
863648 |
aaaatatggttttggtccctgcaaatatgtttcgttttgattttagt |
863602 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1721093 - 1721139
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||| ||||| ||||||| |
|
|
T |
1721093 |
aaaatatggttttggtccttgcaaatatgtctcattttggttttagt |
1721139 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4322185 - 4322139
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
T |
4322185 |
aaaatatagttttggtccctgcaaatatgtcttgttttggttttagt |
4322139 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 12740911 - 12740957
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
12740911 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12740957 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 12741267 - 12741221
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
12741267 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12741221 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 21159457 - 21159503
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
21159457 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22155933 - 22155979
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
22155933 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
22155979 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25610126 - 25610080
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
25610126 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
25610080 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 28452151 - 28452197
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||| |||||| ||||||| |
|
|
T |
28452151 |
aaaatatggttttggtccttgcaaatatgtcttgttttggttttagt |
28452197 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 30034468 - 30034422
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || ||||||||||||||||||||| ||||||| |
|
|
T |
30034468 |
aaaatatggttttgctccttgcaaatatgtctcgttttggttttagt |
30034422 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32119224 - 32119270
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
32119224 |
aaaatatagttttggtccctgcaaatatgtctcgttttagttttagt |
32119270 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35569132 - 35569086
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35569132 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35569086 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38232245 - 38232291
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
T |
38232245 |
aaaatatgattttggtccctgcaaatatgtctcgttttgattttagt |
38232291 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 45005890 - 45005936
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
T |
45005890 |
aaaatatggttttgatccctgcaaatatgtctcgttttgattttagt |
45005936 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 46622125 - 46622079
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||| |||||||| ||||||| |
|
|
T |
46622125 |
aaaatatggttttggtccttgcaaatatgtttcgttttggttttagt |
46622079 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 46901108 - 46901162
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||||| ||||| |||| ||||||||||| |||||||| ||||||||| ||||| |
|
|
T |
46901108 |
aaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgtaa |
46901162 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 47336577 - 47336531
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
47336577 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
47336531 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 51550442 - 51550396
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
51550442 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
51550396 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 277 - 323
Target Start/End: Complemental strand, 52956688 - 52956642
Alignment:
Q |
277 |
gttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
|||||||||| |||||||||| |||||||| ||||||||||||||| |
|
|
T |
52956688 |
gttttggtctctgcaaatatgcatcgttttggttttagtttttgtaa |
52956642 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 54608859 - 54608813
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
54608859 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
54608813 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 315
Target Start/End: Original strand, 25710515 - 25710560
Alignment:
Q |
270 |
aaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
25710560 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 35533283 - 35533328
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttag |
314 |
Q |
|
|
||||||| |||||||||| ||||||||||||| |||||| |||||| |
|
|
T |
35533283 |
aaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 277 - 313
Target Start/End: Complemental strand, 50009272 - 50009236
Alignment:
Q |
277 |
gttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
T |
50009272 |
gttttggtccttgcaaatatgcctcgttttgatttta |
50009236 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 31)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 39520726 - 39520680
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
39520726 |
aaaatatggttttggtccttgcaaatatgtctcgttttgattttagt |
39520680 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 19005602 - 19005649
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
19005602 |
aaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt |
19005649 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 25547492 - 25547440
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
25547492 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
25547440 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 44403251 - 44403199
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
44403251 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
44403199 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 323
Target Start/End: Complemental strand, 48359077 - 48359017
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||||||||||||| |||||||| |||||| |
|
|
T |
48359077 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaa |
48359017 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 3807868 - 3807915
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
3807868 |
aaaatatagttttggttcctgcaaatatgtctcgttttggttttagtt |
3807915 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 252 - 315
Target Start/End: Original strand, 19783802 - 19783865
Alignment:
Q |
252 |
ttatatgatcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||| || ||| ||||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
19783802 |
ttatatgaaaataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
19783865 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Complemental strand, 28529205 - 28529162
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttt |
312 |
Q |
|
|
||||||| |||||||||| |||||||||||||||||||| |||| |
|
|
T |
28529205 |
aaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 30352905 - 30352854
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
30352854 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 489068 - 489022
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
T |
489068 |
aaaatatgattttagtctctgcaaatatgtctcgttttgattttagt |
489022 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1614563 - 1614609
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
1614563 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
1614609 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8144299 - 8144345
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
8144299 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8144345 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 9659359 - 9659405
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
T |
9659359 |
aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt |
9659405 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 23399972 - 23399926
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
23399972 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
23399926 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 23676136 - 23676182
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
23676136 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
23676182 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25092164 - 25092210
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
25092164 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25092210 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25988389 - 25988435
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
25988389 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25988435 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26877682 - 26877728
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
26877682 |
aaaatatggttttgatctctgcaaatatgtctcgttttggttttagt |
26877728 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27458403 - 27458449
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
27458403 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
27458449 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 31503779 - 31503733
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
31503779 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
31503733 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35104082 - 35104128
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||| |||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35104082 |
aaaatataattttggtccctgcaaatatgtctcgttttggttttagt |
35104128 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35837928 - 35837974
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35837928 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35837974 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35838333 - 35838287
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35838333 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35838287 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 43058754 - 43058800
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||| ||| ||||||||||||| |||||||||||||| |
|
|
T |
43058754 |
aaaatatagttttagtccctgcaaatatgtcttgttttgattttagt |
43058800 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 46759662 - 46759708
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
46759662 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
46759708 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 6887174 - 6887219
Alignment:
Q |
279 |
tttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| |||||||||||||| |||||| ||||||| |||||||| |
|
|
T |
6887174 |
tttggtccttgcaaatatgtcttgttttggttttagtctttgtaat |
6887219 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 13769771 - 13769824
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
13769771 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 38186370 - 38186415
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttag |
314 |
Q |
|
|
||||||| ||||||||| |||||||||| |||||||||||||||| |
|
|
T |
38186370 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 46304387 - 46304334
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||||||||| ||| ||||||||||| |||||||| ||||||| |
|
|
T |
46304387 |
attggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagt |
46304334 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 1559347 - 1559391
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
T |
1559347 |
aaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 5308321 - 5308373
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
5308321 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt |
5308373 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 15722614 - 15722660
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
T |
15722614 |
aaaatatggttttggtctatgcaaatatgtctcgttttgattttagt |
15722660 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 14656256 - 14656210
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
14656256 |
aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
14656210 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 17765013 - 17765067
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||| |
|
|
T |
17765013 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaa |
17765067 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 18024015 - 18024061
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||||||||||||||| ||||||||| ||||||| |
|
|
T |
18024015 |
aaaatatggttttggtctttgcaaatatgcctcgttttggttttagt |
18024061 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 31276336 - 31276290
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
T |
31276336 |
aaaataaagttttggtccctgcaaatatgtctcgttttgattttagt |
31276290 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 24901237 - 24901289
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
24901237 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24901289 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 10910628 - 10910679
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| |||||||||| | |||||||||||||||||| ||||||| |
|
|
T |
10910628 |
tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagt |
10910679 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 1214992 - 1214946
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
1214992 |
aaaatatggttttgatctctgcaaatatgtctcgttttggttttagt |
1214946 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 3276350 - 3276304
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
3276350 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3276304 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 3968649 - 3968695
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
3968649 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3968695 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 6412222 - 6412268
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
6412222 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
6412268 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 6412575 - 6412529
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
6412575 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
6412529 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 8170147 - 8170101
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
8170147 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8170101 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10910960 - 10910914
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
10910960 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10910914 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 12757614 - 12757660
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
12757614 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12757660 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19690397 - 19690443
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
19690397 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19690443 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 20467355 - 20467401
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||||||| |||||||||| ||||||||| ||||||| |
|
|
T |
20467355 |
aaaatatagttttggtccctgcaaatatgcctcgttttggttttagt |
20467401 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 21385255 - 21385301
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
21385255 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
21385301 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 22543714 - 22543668
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
22543714 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
22543668 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33131846 - 33131800
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||||||||||||||| ||||||||| ||||||| |
|
|
T |
33131846 |
aaaatatggttttagtctttgcaaatatgcctcgttttggttttagt |
33131800 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 317816 - 317861
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttag |
314 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
T |
317816 |
aaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 315
Target Start/End: Original strand, 11925752 - 11925789
Alignment:
Q |
278 |
ttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||| |
|
|
T |
11925752 |
ttttggtccctgcaaatatgtctcgttttgattttagt |
11925789 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 19690762 - 19690717
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg |
307 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
T |
19690762 |
attggcgaaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 31167202 - 31167150
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||| ||||||||||||||||| |
|
|
T |
31167202 |
ttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagt |
31167150 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 35)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 28449210 - 28449166
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
T |
28449210 |
aaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 11693117 - 11693071
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
T |
11693117 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattttagt |
11693071 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 47022744 - 47022790
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
47022744 |
aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47022790 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 47532667 - 47532621
Alignment:
Q |
270 |
aaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||||| ||||||||| ||||||||||||||||||||| |||||||| |
|
|
T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagtt |
47532621 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 13073757 - 13073809
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
13073757 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
13073809 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 42824093 - 42824041
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
T |
42824093 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt |
42824041 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 52543426 - 52543470
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
52543426 |
aaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Original strand, 12152283 - 12152314
Alignment:
Q |
331 |
tttttaaaaatcaaaagattttgcagagacta |
362 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
12152283 |
tttttaaaaatcaaaagattttgcagagacta |
12152314 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 45593582 - 45593535
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||| |||| |||||||||||||||||||| |||||||| |
|
|
T |
45593582 |
aaaatatggttttagtctctgcaaatatgtctcgttttggttttagtt |
45593535 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 53916043 - 53915996
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
53916043 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
53915996 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 54208821 - 54208766
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| | |||||| |
|
|
T |
54208821 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat |
54208766 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5797485 - 5797531
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
5797485 |
aaaatatgattttggtctctgcaaatatgtctcgttttggttttagt |
5797531 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13530383 - 13530429
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
T |
13530383 |
aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt |
13530429 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13631232 - 13631278
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
13631232 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
13631278 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 14791802 - 14791756
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
14791802 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
14791756 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 15555634 - 15555588
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
15555634 |
aaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
15555588 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19903265 - 19903311
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||||||||| || |||||||||||||| ||||||||||||| |
|
|
T |
19903265 |
aaaatatagttttgatccctgcaaatatgtctcattttgattttagt |
19903311 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 19903651 - 19903605
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
19903651 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19903605 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22584291 - 22584337
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
22584291 |
aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
22584337 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25423928 - 25423974
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
25423928 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25423974 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25424308 - 25424262
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
25424308 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25424262 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 29420533 - 29420487
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
29420533 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29420487 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35420699 - 35420653
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||| |||| ||||||| |
|
|
T |
35420699 |
aaaatatggttttggtccttgcaaatatgtctcgatttggttttagt |
35420653 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35464022 - 35464068
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35464022 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35464068 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 36702004 - 36702050
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
36702004 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
36702050 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 43231092 - 43231138
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
43231092 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
43231138 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 52441767 - 52441813
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
52441767 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
52441813 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 52442088 - 52442042
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
52442088 |
aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
52442042 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 53915687 - 53915733
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
53915687 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
53915733 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 362
Target Start/End: Complemental strand, 4211713 - 4211680
Alignment:
Q |
329 |
catttttaaaaatcaaaagattttgcagagacta |
362 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
4211713 |
catttttaaaaatcaaaagattttgcagggacta |
4211680 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 19321862 - 19321809
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| ||||||||||| |||||||| ||||||| |
|
|
T |
19321862 |
attggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagt |
19321809 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 5827653 - 5827705
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||| ||||| ||||||| |
|
|
T |
5827653 |
ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
5827705 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 8904890 - 8904934
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
T |
8904890 |
aaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 28809009 - 28809061
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||||| |||||||| ||||||| |
|
|
T |
28809009 |
ttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagt |
28809061 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 47274232 - 47274180
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
T |
47274232 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 33)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 4736209 - 4736247
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttg |
307 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
4736209 |
aaaatatggttttggtctttgcaaatatgtctcgttttg |
4736247 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 36973350 - 36973404
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||||| ||||||| |||||||||| | |||||||||||||||||| |||||||| |
|
|
T |
36973350 |
attggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagtt |
36973404 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 37271702 - 37271656
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
T |
37271702 |
aaaatatggttttggtccctgcaaatatgtctcgttttgattttagt |
37271656 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 35928461 - 35928408
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35928461 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35928408 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 38452392 - 38452348
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
T |
38452392 |
aaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 45137 - 45188
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
45137 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
45188 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Complemental strand, 12145179 - 12145136
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttt |
312 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
12145179 |
aaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 20690737 - 20690792
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| | |||||| |
|
|
T |
20690737 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat |
20690792 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Complemental strand, 28213583 - 28213552
Alignment:
Q |
331 |
tttttaaaaatcaaaagattttgcagagacta |
362 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
28213583 |
tttttaaaaatcaaaagattttgcagagacta |
28213552 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 35609633 - 35609586
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
35609633 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
35609586 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1104862 - 1104908
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
1104862 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
1104908 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1381251 - 1381297
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
1381251 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
1381297 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4203766 - 4203720
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
4203766 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
4203720 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5614170 - 5614216
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
5614170 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5904012 - 5904058
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||| || ||||||||||| ||||||||||||||||| |
|
|
T |
5904012 |
aaaatatggttttgctccttgcaaatatgcctcgttttgattttagt |
5904058 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5917130 - 5917176
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
5917130 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
5917176 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 6912853 - 6912807
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
6912853 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
6912807 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10744050 - 10744004
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
10744050 |
aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
10744004 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 14318049 - 14318095
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
14318049 |
aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
14318095 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 18046042 - 18046088
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
18046042 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
18046088 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 18258523 - 18258477
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
18258523 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
18258477 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19565471 - 19565517
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
19565471 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19565517 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19685021 - 19685067
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
19685021 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19685067 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20418012 - 20417966
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
T |
20418012 |
aaaatatggtttaagtctctgcaaatatgtctcgttttgattttagt |
20417966 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20986085 - 20986039
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
20986085 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
20986039 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 316
Target Start/End: Complemental strand, 29366952 - 29366898
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||||| ||||||| ||||| ||| |||||||||||||||||||| |||||||| |
|
|
T |
29366952 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtt |
29366898 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 30888164 - 30888210
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
30888164 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
30888210 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 36973706 - 36973660
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| || ||||||||||||||||||||||||| |
|
|
T |
36973706 |
aaaatatggttttggtccctggaaatatgtctcgttttgattttagt |
36973660 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Complemental strand, 35877048 - 35877003
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttag |
314 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
T |
35877048 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 2636667 - 2636719
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||| ||||||||||| ||||||| |
|
|
T |
2636667 |
ttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt |
2636719 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 324
Target Start/End: Complemental strand, 5104002 - 5103942
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
|||| ||||||| |||||||| |||||||||||||| ||||| ||||||||| |||||| |
|
|
T |
5104002 |
tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgtaat |
5103942 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 323
Target Start/End: Original strand, 38962804 - 38962864
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||| ||||||| ||||| ||| || ||||||||||||||||| |||||||| |||||| |
|
|
T |
38962804 |
ttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgtaa |
38962864 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 324
Target Start/End: Original strand, 42553641 - 42553701
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
|||| ||||||| |||||||| |||||||||||||||||||| ||||||| | |||||| |
|
|
T |
42553641 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaat |
42553701 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 36)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26207282 - 26207328
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
26207282 |
aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
26207328 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32420102 - 32420148
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
32420102 |
aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
32420148 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 32906236 - 32906190
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
T |
32906236 |
aaaatatgattttggtccttgcaaatatgtctcgttttgattttagt |
32906190 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 10631161 - 10631214
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
10631161 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10631214 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 24977775 - 24977828
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
24977775 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24977828 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 40718108 - 40718160
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
40718108 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
40718160 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 49073695 - 49073739
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
49073695 |
aaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 262 - 313
Target Start/End: Complemental strand, 12322973 - 12322922
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
T |
12322973 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 24978118 - 24978071
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||||||||||||| | ||||||||| ||||||||| |||||||| |
|
|
T |
24978118 |
aaaatatagttttggtcctggcaaatatgcctcgttttggttttagtt |
24978071 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 35056529 - 35056580
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
35056529 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35056580 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Original strand, 39025113 - 39025156
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttt |
312 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
39025113 |
aaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 3247202 - 3247248
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
3247202 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3247248 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 4789312 - 4789358
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
4789312 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
4789358 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 7818786 - 7818840
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||||||||||| ||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
T |
7818786 |
aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgtaa |
7818840 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8140438 - 8140484
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
8140438 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8140484 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10887594 - 10887548
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
10887594 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10887548 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 12360964 - 12360918
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
12360964 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12360918 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 15526358 - 15526312
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
15526358 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
15526312 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19720716 - 19720762
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
19720716 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19720762 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 22674207 - 22674261
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa |
323 |
Q |
|
|
||||||| |||| |||| |||||||||||||||||||| ||||||| ||||||| |
|
|
T |
22674207 |
aaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtctttgtaa |
22674261 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27521580 - 27521626
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
27521580 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
27521626 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 30322933 - 30322979
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
30322933 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
30322979 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 33000309 - 33000355
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
33000309 |
aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
33000355 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33000665 - 33000619
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
33000665 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
33000619 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38150852 - 38150898
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
38150852 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
38150898 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 39747831 - 39747785
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
39747831 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
39747785 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 45380276 - 45380322
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
45380276 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
45380322 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 324
Target Start/End: Original strand, 12322602 - 12322663
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||| ||||||| |||||| || ||||||||||| |||||||||||||||| ||||||| |
|
|
T |
12322602 |
ttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaat |
12322663 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Complemental strand, 24654163 - 24654118
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttag |
314 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
T |
24654163 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 17130079 - 17130035
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
T |
17130079 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 31060785 - 31060837
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||||||| ||||||||||||| |||||| ||||||| |
|
|
T |
31060785 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagt |
31060837 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 271 - 315
Target Start/End: Original strand, 32035442 - 32035486
Alignment:
Q |
271 |
aatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| |||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagt |
32035486 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 33067726 - 33067682
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||| |
|
|
T |
33067726 |
aaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 45638890 - 45638846
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||| |
|
|
T |
45638890 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 50428877 - 50428921
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||| |
|
|
T |
50428877 |
aaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 52254481 - 52254429
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| |||||||||| ||||||||||||||||| |
|
|
T |
52254481 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
52254429 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 33)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 42695865 - 42695918
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
42695865 |
attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42695918 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 1497608 - 1497660
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||| ||||| ||| ||||||||||| ||||||||||||||||| |
|
|
T |
1497608 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagt |
1497660 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 45442320 - 45442364
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgatttta |
313 |
Q |
|
|
||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
T |
45442320 |
aaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 260 - 315
Target Start/End: Original strand, 11713480 - 11713535
Alignment:
Q |
260 |
tcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||| ||||||| ||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
11713480 |
tcattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
11713535 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 19831512 - 19831559
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||| |||||||||||||||| |||||||| |||||||| |
|
|
T |
19831512 |
aaaatatggttttagtctttgcaaatatgtttcgttttggttttagtt |
19831559 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 260 - 315
Target Start/End: Original strand, 26813861 - 26813916
Alignment:
Q |
260 |
tcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||| ||||||| ||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
26813861 |
tcattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26813916 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Complemental strand, 29831999 - 29831968
Alignment:
Q |
331 |
tttttaaaaatcaaaagattttgcagagacta |
362 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
29831999 |
tttttaaaaatcaaaagattttgcagagacta |
29831968 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 31225719 - 31225766
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
T |
31225719 |
aaaatatagttttagtccctgcaaatatgcctcgttttgattttagtt |
31225766 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 36806897 - 36806846
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
36806897 |
tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
36806846 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 36815831 - 36815784
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
T |
36815831 |
aaaatatggttttggtccatgcaaatatgtctcgttttggttttagtt |
36815784 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 37229038 - 37228983
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| ||||||||| ||||||||| | |||||||| |||||||||||||||| |
|
|
T |
37229038 |
aaaatatggttttggtccctgcaaatatatttcgttttggttttagtttttgtaat |
37228983 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 2481197 - 2481243
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| |||||||| ||||||||||||||||||||| ||||||| |
|
|
T |
2481197 |
aaaatatggttttggtacttgcaaatatgtctcgttttggttttagt |
2481243 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4424181 - 4424135
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
4424181 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
4424135 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13215064 - 13215110
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
13215064 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
13215110 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13850526 - 13850572
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||||||||||| ||| ||||||||||||||| |||| ||||||| |
|
|
T |
13850526 |
aaaatatagttttgatctctgcaaatatgtctcgatttggttttagt |
13850572 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 20131321 - 20131367
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
20131321 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20131367 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20939321 - 20939275
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
20939321 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20939275 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 23990192 - 23990146
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
T |
23990192 |
aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
23990146 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25705089 - 25705135
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
25705089 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
25705135 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25954422 - 25954376
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| ||||||||||| ||||||||||||||||| |
|
|
T |
25954422 |
aaaatatggttttagtccttgcaaatatgcctcgttttgattttagt |
25954376 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26238817 - 26238863
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
26238817 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
26238863 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 26239156 - 26239110
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
26239156 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
26239110 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 31644845 - 31644891
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
31644845 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
31644891 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33576113 - 33576067
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
33576113 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
33576067 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 324
Target Start/End: Complemental strand, 34318086 - 34318024
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
|||||| ||||||| ||||||||| | |||||||| ||||||||||||||||| ||||||| |
|
|
T |
34318086 |
attggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaat |
34318024 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 41451841 - 41451887
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
41451841 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
41451887 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 44559066 - 44559112
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
44559066 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559112 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 44559405 - 44559359
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
44559405 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559359 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 4042893 - 4042840
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| |||| |||| |||||||||||||||||||| ||||||| |
|
|
T |
4042893 |
attggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt |
4042840 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 5790902 - 5790849
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||||| ||||||| ||||| ||| |||||||||||||||||||| ||||||| |
|
|
T |
5790902 |
attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
5790849 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 316
Target Start/End: Original strand, 9195053 - 9195105
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt |
316 |
Q |
|
|
|||| ||||||| ||||| ||| |||||||||||||||||||| |||||||| |
|
|
T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtt |
9195105 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 306
Target Start/End: Complemental strand, 34964162 - 34964118
Alignment:
Q |
262 |
attggcaaaaatatagttttggtctttgcaaatatgtctcgtttt |
306 |
Q |
|
|
|||||| ||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
34964162 |
attggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
34964118 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 362
Target Start/End: Complemental strand, 38231642 - 38231610
Alignment:
Q |
330 |
atttttaaaaatcaaaagattttgcagagacta |
362 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |
|
|
T |
38231642 |
atttttaaaaatcaaaagattttgcagggacta |
38231610 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0060 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 8638 - 8583
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat |
324 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
8638 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaat |
8583 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8334 - 8380
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
8334 |
aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 2884 - 2833
Alignment:
Q |
264 |
tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
|||| ||||||| ||||||||| ||||||||||||||||||||| |||||| |
|
|
T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagt |
2833 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0160 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 27360 - 27314
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
27360 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
27314 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0056 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 50074 - 50028
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
50074 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
50028 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 55175 - 55129
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
55175 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
55129 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 47929 - 47975
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
47929 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
47975 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0001 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 148278 - 148232
Alignment:
Q |
269 |
aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
148278 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
148232 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: scaffold0339 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 3457 - 3405
Alignment:
Q |
263 |
ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt |
315 |
Q |
|
|
||||| ||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
T |
3457 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University