View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0710_high_7 (Length: 414)

Name: NF0710_high_7
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0710_high_7
NF0710_high_7
[»] chr8 (33 HSPs)
chr8 (8-324)||(37126054-37126372)
chr8 (8-237)||(37113405-37113634)
chr8 (262-315)||(1778561-1778614)
chr8 (263-315)||(7185954-7186006)
chr8 (263-315)||(14489023-14489075)
chr8 (263-315)||(34963614-34963666)
chr8 (263-315)||(42133104-42133156)
chr8 (264-315)||(4621304-4621355)
chr8 (264-315)||(8298586-8298637)
chr8 (269-316)||(9496345-9496392)
chr8 (272-315)||(23360378-23360421)
chr8 (269-316)||(25600234-25600281)
chr8 (264-315)||(35346628-35346679)
chr8 (269-315)||(3512216-3512262)
chr8 (269-315)||(7326090-7326136)
chr8 (269-315)||(7420234-7420280)
chr8 (269-315)||(8094483-8094529)
chr8 (269-315)||(8298925-8298971)
chr8 (269-315)||(9175016-9175062)
chr8 (269-315)||(10337123-10337169)
chr8 (269-315)||(11019524-11019570)
chr8 (269-315)||(11976686-11976732)
chr8 (269-315)||(13154890-13154936)
chr8 (269-315)||(13232202-13232248)
chr8 (269-315)||(22650468-22650514)
chr8 (262-316)||(23939544-23939598)
chr8 (269-315)||(25600547-25600593)
chr8 (269-315)||(27117757-27117803)
chr8 (269-315)||(32725911-32725957)
chr8 (269-315)||(35097332-35097378)
chr8 (269-315)||(35346948-35346994)
chr8 (263-313)||(42132862-42132912)
chr8 (263-315)||(44998213-44998265)
[»] chr3 (37 HSPs)
chr3 (269-324)||(40279276-40279331)
chr3 (269-315)||(29678028-29678074)
chr3 (263-315)||(20644503-20644555)
chr3 (269-315)||(19297899-19297945)
chr3 (263-316)||(43441268-43441321)
chr3 (263-315)||(40169604-40169656)
chr3 (269-316)||(474357-474404)
chr3 (264-315)||(4034716-4034767)
chr3 (264-315)||(26090028-26090079)
chr3 (269-324)||(29490684-29490739)
chr3 (269-324)||(35177259-35177314)
chr3 (269-324)||(36672967-36673022)
chr3 (269-316)||(45521785-45521832)
chr3 (269-315)||(474048-474094)
chr3 (269-315)||(863602-863648)
chr3 (269-315)||(1721093-1721139)
chr3 (269-315)||(4322139-4322185)
chr3 (269-315)||(12740911-12740957)
chr3 (269-315)||(12741221-12741267)
chr3 (269-315)||(21159457-21159503)
chr3 (269-315)||(22155933-22155979)
chr3 (269-315)||(25610080-25610126)
chr3 (269-315)||(28452151-28452197)
chr3 (269-315)||(30034422-30034468)
chr3 (269-315)||(32119224-32119270)
chr3 (269-315)||(35569086-35569132)
chr3 (269-315)||(38232245-38232291)
chr3 (269-315)||(45005890-45005936)
chr3 (269-315)||(46622079-46622125)
chr3 (269-323)||(46901108-46901162)
chr3 (269-315)||(47336531-47336577)
chr3 (269-315)||(51550396-51550442)
chr3 (277-323)||(52956642-52956688)
chr3 (269-315)||(54608813-54608859)
chr3 (270-315)||(25710515-25710560)
chr3 (269-314)||(35533283-35533328)
chr3 (277-313)||(50009236-50009272)
[»] chr7 (31 HSPs)
chr7 (269-315)||(39520680-39520726)
chr7 (269-316)||(19005602-19005649)
chr7 (263-315)||(25547440-25547492)
chr7 (263-315)||(44403199-44403251)
chr7 (263-323)||(48359017-48359077)
chr7 (269-316)||(3807868-3807915)
chr7 (252-315)||(19783802-19783865)
chr7 (269-312)||(28529162-28529205)
chr7 (264-315)||(30352854-30352905)
chr7 (269-315)||(489022-489068)
chr7 (269-315)||(1614563-1614609)
chr7 (269-315)||(8144299-8144345)
chr7 (269-315)||(9659359-9659405)
chr7 (269-315)||(23399926-23399972)
chr7 (269-315)||(23676136-23676182)
chr7 (269-315)||(25092164-25092210)
chr7 (269-315)||(25988389-25988435)
chr7 (269-315)||(26877682-26877728)
chr7 (269-315)||(27458403-27458449)
chr7 (269-315)||(31503733-31503779)
chr7 (269-315)||(35104082-35104128)
chr7 (269-315)||(35837928-35837974)
chr7 (269-315)||(35838287-35838333)
chr7 (269-315)||(43058754-43058800)
chr7 (269-315)||(46759662-46759708)
chr7 (279-324)||(6887174-6887219)
chr7 (262-315)||(13769771-13769824)
chr7 (269-314)||(38186370-38186415)
chr7 (262-315)||(46304334-46304387)
chr7 (269-313)||(1559347-1559391)
chr7 (263-315)||(5308321-5308373)
[»] chr6 (24 HSPs)
chr6 (269-315)||(15722614-15722660)
chr6 (269-315)||(14656210-14656256)
chr6 (269-323)||(17765013-17765067)
chr6 (269-315)||(18024015-18024061)
chr6 (269-315)||(31276290-31276336)
chr6 (263-315)||(24901237-24901289)
chr6 (264-315)||(10910628-10910679)
chr6 (269-315)||(1214946-1214992)
chr6 (269-315)||(3276304-3276350)
chr6 (269-315)||(3968649-3968695)
chr6 (269-315)||(6412222-6412268)
chr6 (269-315)||(6412529-6412575)
chr6 (269-315)||(8170101-8170147)
chr6 (269-315)||(10910914-10910960)
chr6 (269-315)||(12757614-12757660)
chr6 (269-315)||(19690397-19690443)
chr6 (269-315)||(20467355-20467401)
chr6 (269-315)||(21385255-21385301)
chr6 (269-315)||(22543668-22543714)
chr6 (269-315)||(33131800-33131846)
chr6 (269-314)||(317816-317861)
chr6 (278-315)||(11925752-11925789)
chr6 (262-307)||(19690717-19690762)
chr6 (263-315)||(31167150-31167202)
[»] chr4 (35 HSPs)
chr4 (269-313)||(28449166-28449210)
chr4 (269-315)||(11693071-11693117)
chr4 (269-315)||(47022744-47022790)
chr4 (270-316)||(47532621-47532667)
chr4 (263-315)||(13073757-13073809)
chr4 (263-315)||(42824041-42824093)
chr4 (269-313)||(52543426-52543470)
chr4 (331-362)||(12152283-12152314)
chr4 (269-316)||(45593535-45593582)
chr4 (269-316)||(53915996-53916043)
chr4 (269-324)||(54208766-54208821)
chr4 (269-315)||(5797485-5797531)
chr4 (269-315)||(13530383-13530429)
chr4 (269-315)||(13631232-13631278)
chr4 (269-315)||(14791756-14791802)
chr4 (269-315)||(15555588-15555634)
chr4 (269-315)||(19903265-19903311)
chr4 (269-315)||(19903605-19903651)
chr4 (269-315)||(22584291-22584337)
chr4 (269-315)||(25423928-25423974)
chr4 (269-315)||(25424262-25424308)
chr4 (269-315)||(29420487-29420533)
chr4 (269-315)||(35420653-35420699)
chr4 (269-315)||(35464022-35464068)
chr4 (269-315)||(36702004-36702050)
chr4 (269-315)||(43231092-43231138)
chr4 (269-315)||(52441767-52441813)
chr4 (269-315)||(52442042-52442088)
chr4 (269-315)||(53915687-53915733)
chr4 (329-362)||(4211680-4211713)
chr4 (262-315)||(19321809-19321862)
chr4 (263-315)||(5827653-5827705)
chr4 (269-313)||(8904890-8904934)
chr4 (263-315)||(28809009-28809061)
chr4 (263-315)||(47274180-47274232)
[»] chr5 (33 HSPs)
chr5 (269-307)||(4736209-4736247)
chr5 (262-316)||(36973350-36973404)
chr5 (269-315)||(37271656-37271702)
chr5 (262-315)||(35928408-35928461)
chr5 (269-313)||(38452348-38452392)
chr5 (264-315)||(45137-45188)
chr5 (269-312)||(12145136-12145179)
chr5 (269-324)||(20690737-20690792)
chr5 (331-362)||(28213552-28213583)
chr5 (269-316)||(35609586-35609633)
chr5 (269-315)||(1104862-1104908)
chr5 (269-315)||(1381251-1381297)
chr5 (269-315)||(4203720-4203766)
chr5 (269-315)||(5614170-5614216)
chr5 (269-315)||(5904012-5904058)
chr5 (269-315)||(5917130-5917176)
chr5 (269-315)||(6912807-6912853)
chr5 (269-315)||(10744004-10744050)
chr5 (269-315)||(14318049-14318095)
chr5 (269-315)||(18046042-18046088)
chr5 (269-315)||(18258477-18258523)
chr5 (269-315)||(19565471-19565517)
chr5 (269-315)||(19685021-19685067)
chr5 (269-315)||(20417966-20418012)
chr5 (269-315)||(20986039-20986085)
chr5 (262-316)||(29366898-29366952)
chr5 (269-315)||(30888164-30888210)
chr5 (269-315)||(36973660-36973706)
chr5 (269-314)||(35877003-35877048)
chr5 (263-315)||(2636667-2636719)
chr5 (264-324)||(5103942-5104002)
chr5 (263-323)||(38962804-38962864)
chr5 (264-324)||(42553641-42553701)
[»] chr1 (36 HSPs)
chr1 (269-315)||(26207282-26207328)
chr1 (269-315)||(32420102-32420148)
chr1 (269-315)||(32906190-32906236)
chr1 (262-315)||(10631161-10631214)
chr1 (262-315)||(24977775-24977828)
chr1 (263-315)||(40718108-40718160)
chr1 (269-313)||(49073695-49073739)
chr1 (262-313)||(12322922-12322973)
chr1 (269-316)||(24978071-24978118)
chr1 (264-315)||(35056529-35056580)
chr1 (269-312)||(39025113-39025156)
chr1 (269-315)||(3247202-3247248)
chr1 (269-315)||(4789312-4789358)
chr1 (269-323)||(7818786-7818840)
chr1 (269-315)||(8140438-8140484)
chr1 (269-315)||(10887548-10887594)
chr1 (269-315)||(12360918-12360964)
chr1 (269-315)||(15526312-15526358)
chr1 (269-315)||(19720716-19720762)
chr1 (269-323)||(22674207-22674261)
chr1 (269-315)||(27521580-27521626)
chr1 (269-315)||(30322933-30322979)
chr1 (269-315)||(33000309-33000355)
chr1 (269-315)||(33000619-33000665)
chr1 (269-315)||(38150852-38150898)
chr1 (269-315)||(39747785-39747831)
chr1 (269-315)||(45380276-45380322)
chr1 (263-324)||(12322602-12322663)
chr1 (269-314)||(24654118-24654163)
chr1 (269-313)||(17130035-17130079)
chr1 (263-315)||(31060785-31060837)
chr1 (271-315)||(32035442-32035486)
chr1 (269-313)||(33067682-33067726)
chr1 (269-313)||(45638846-45638890)
chr1 (269-313)||(50428877-50428921)
chr1 (263-315)||(52254429-52254481)
[»] chr2 (33 HSPs)
chr2 (262-315)||(42695865-42695918)
chr2 (263-315)||(1497608-1497660)
chr2 (269-313)||(45442320-45442364)
chr2 (260-315)||(11713480-11713535)
chr2 (269-316)||(19831512-19831559)
chr2 (260-315)||(26813861-26813916)
chr2 (331-362)||(29831968-29831999)
chr2 (269-316)||(31225719-31225766)
chr2 (264-315)||(36806846-36806897)
chr2 (269-316)||(36815784-36815831)
chr2 (269-324)||(37228983-37229038)
chr2 (269-315)||(2481197-2481243)
chr2 (269-315)||(4424135-4424181)
chr2 (269-315)||(13215064-13215110)
chr2 (269-315)||(13850526-13850572)
chr2 (269-315)||(20131321-20131367)
chr2 (269-315)||(20939275-20939321)
chr2 (269-315)||(23990146-23990192)
chr2 (269-315)||(25705089-25705135)
chr2 (269-315)||(25954376-25954422)
chr2 (269-315)||(26238817-26238863)
chr2 (269-315)||(26239110-26239156)
chr2 (269-315)||(31644845-31644891)
chr2 (269-315)||(33576067-33576113)
chr2 (262-324)||(34318024-34318086)
chr2 (269-315)||(41451841-41451887)
chr2 (269-315)||(44559066-44559112)
chr2 (269-315)||(44559359-44559405)
chr2 (262-315)||(4042840-4042893)
chr2 (262-315)||(5790849-5790902)
chr2 (264-316)||(9195053-9195105)
chr2 (262-306)||(34964118-34964162)
chr2 (330-362)||(38231610-38231642)
[»] scaffold0060 (2 HSPs)
scaffold0060 (269-324)||(8583-8638)
scaffold0060 (269-315)||(8334-8380)
[»] scaffold0007 (1 HSPs)
scaffold0007 (264-315)||(2833-2884)
[»] scaffold0160 (1 HSPs)
scaffold0160 (269-315)||(27314-27360)
[»] scaffold0056 (2 HSPs)
scaffold0056 (269-315)||(50028-50074)
scaffold0056 (269-315)||(55129-55175)
[»] scaffold0005 (1 HSPs)
scaffold0005 (269-315)||(47929-47975)
[»] scaffold0001 (1 HSPs)
scaffold0001 (269-315)||(148232-148278)
[»] scaffold0339 (1 HSPs)
scaffold0339 (263-315)||(3405-3457)


Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 33)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 8 - 324
Target Start/End: Complemental strand, 37126372 - 37126054
Alignment:
8 tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaag 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37126372 tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatatttgtgctgaccggacttgaggctaag 37126273  T
108 cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccgg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
37126272 cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtattttgctatacagagtttgcggtggaaattccgg 37126173  T
208 ttgcaggtactttctcttattctcactataatctttcttatgcattatatgatcatt---ggcaaaaatatagttttggtctttgcaaatatgtctcgtt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||  ||||||||  || ||||||||||||||    
37126172 ttgcaggtactttctcttattctcactataatctttcttatgcattatatgatcatttgcagcaaaaatatgattttggtc-ctgaaaatatgtctcgtt 37126074  T
305 ttgattttagtttttgtaat 324  Q
    ||||||||||| ||||||||    
37126073 ttgattttagtctttgtaat 37126054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 8 - 237
Target Start/End: Complemental strand, 37113634 - 37113405
Alignment:
8 tgagatgaagaagacgctgaactggtgggacttgatgtggtttggtatcggtgcggtcgtcggctccggaatattcgtgctgaccggacttgaggctaag 107  Q
    ||||||||||||||| ||||| |||||||||||||||||||| ||||| || || ||| | || || |||||||| ||||| |||||||||||||||| |    
37113634 tgagatgaagaagacactgaattggtgggacttgatgtggttcggtatgggcgccgtcattggttctggaatatttgtgcttaccggacttgaggctagg 37113535  T
108 cagcatgcaggtccggcagttgtgttgtcatttgtcatctccggcatatctgctttgttatcagtgttttgctatacagagtttgcggtggaaattccgg 207  Q
    ||| | ||||||||||||||||| ||||| |||||||||||||| |||||||||||| |||| |||||||| |||||||| ||||| |||||||||||||    
37113534 caggaagcaggtccggcagttgtattgtcgtttgtcatctccggtatatctgctttgctatcggtgttttgttatacagaatttgctgtggaaattccgg 37113435  T
208 ttgcaggtactttctcttattctcactata 237  Q
    |||||||||||||||||||  |||||||||    
37113434 ttgcaggtactttctcttaccctcactata 37113405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 1778561 - 1778614
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
1778561 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1778614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 7186006 - 7185954
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
7186006 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 7185954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 14489075 - 14489023
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
14489075 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 14489023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 34963666 - 34963614
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
34963666 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 34963614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 42133156 - 42133104
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
42133156 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42133104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 4621355 - 4621304
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| |||||||||||||||||  |||||||||| ||||||||| |||||||    
4621355 tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagt 4621304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 8298586 - 8298637
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
8298586 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8298637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 9496345 - 9496392
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
9496345 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 9496392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 272 - 315
Target Start/End: Original strand, 23360378 - 23360421
Alignment:
272 atatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| |||||||||| ||||||||||||||||||| ||||||||    
23360378 atatggttttggtctctgcaaatatgtctcgttttaattttagt 23360421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 25600234 - 25600281
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
25600234 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 25600281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 35346628 - 35346679
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
35346628 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35346679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 3512262 - 3512216
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
3512262 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3512216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 7326090 - 7326136
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||| ||||||||| |||||||    
7326090 aaaatatggttttggtccttgcaaatatgcctcgttttggttttagt 7326136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 7420234 - 7420280
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
7420234 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 7420280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8094483 - 8094529
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||| |||||||||||||||||||| |||||||    
8094483 aaaatatggttttagtctctgcaaatatgtctcgttttggttttagt 8094529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 8298971 - 8298925
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
8298971 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8298925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 9175016 - 9175062
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||  |||||||| ||||||||||||||||||||| |||||||    
9175016 aaaatatgattttggtccttgcaaatatgtctcgttttggttttagt 9175062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 10337123 - 10337169
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
10337123 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10337169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 11019524 - 11019570
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
11019524 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 11019570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 11976732 - 11976686
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
11976732 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 11976686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13154890 - 13154936
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||| || ||||||||||| ||||||||| |||||||    
13154890 aaaatatagttttgatccttgcaaatatgcctcgttttggttttagt 13154936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13232202 - 13232248
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
13232202 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13232248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22650468 - 22650514
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
22650468 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 22650514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 23939544 - 23939598
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||  ||||||||    
23939544 attggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagtt 23939598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25600593 - 25600547
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||||||  ||||||||||||| |||||| |||||||    
25600593 aaaatatagttttggtccctgcaaatatgtcttgttttggttttagt 25600547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27117757 - 27117803
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||  ||||||||||||||||||||||||||||    
27117757 aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 27117803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32725911 - 32725957
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
32725911 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 32725957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35097332 - 35097378
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35097332 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35097378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35346994 - 35346948
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35346994 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35346948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 263 - 313
Target Start/End: Original strand, 42132862 - 42132912
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||    
42132862 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 42132912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 44998265 - 44998213
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||| ||| | |||||||||||||||||| |||||||    
44998265 ttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt 44998213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 37)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 40279331 - 40279276
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||||||||||||||||| |||||| ||||||||| ||||||    
40279331 aaaatatggttttggtctttgcaaatatgtcttgttttgtttttagtttatgtaat 40279276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 29678028 - 29678074
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||||||||||||||||||||||| ||||||||| |||||||    
29678028 aaaatatagttttggtctttgcaaatatgcctcgttttggttttagt 29678074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 20644503 - 20644555
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| |||||||||||||||||  |||||||||||||| |||||||||||||    
20644503 ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagt 20644555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 19297945 - 19297899
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||||||||||| ||| ||||||||||||||||| |||||||    
19297945 aaaatatagttttggtccttgtaaatatgtctcgttttgtttttagt 19297899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 263 - 316
Target Start/End: Original strand, 43441268 - 43441321
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| ||||||||    
43441268 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 43441321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 40169656 - 40169604
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| |||  ||||||||||||||||||||||||||||    
40169656 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 40169604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 474404 - 474357
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
474404 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 474357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 4034716 - 4034767
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
4034716 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4034767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 26090079 - 26090028
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
26090079 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 26090028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 29490739 - 29490684
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||| | ||||||    
29490739 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat 29490684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 35177259 - 35177314
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    |||||||  ||||||||  |||||||||||||||||||| ||||||||| ||||||    
35177259 aaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgtaat 35177314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 36672967 - 36673022
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||| ||||||||||||| |||||| ||||||| | ||||||    
36672967 aaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaat 36673022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 45521832 - 45521785
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| ||||| |||||||||||||||| |||||||| ||||||||    
45521832 aaaatatggttttagtctttgcaaatatgtttcgttttggttttagtt 45521785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 474048 - 474094
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
474048 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 474094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 863648 - 863602
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  ||||||||||| ||||||||||||||||    
863648 aaaatatggttttggtccctgcaaatatgtttcgttttgattttagt 863602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1721093 - 1721139
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||||||| ||||| |||||||    
1721093 aaaatatggttttggtccttgcaaatatgtctcattttggttttagt 1721139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4322185 - 4322139
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||||||  ||||||||||||| |||||| |||||||    
4322185 aaaatatagttttggtccctgcaaatatgtcttgttttggttttagt 4322139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 12740911 - 12740957
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
12740911 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12740957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 12741267 - 12741221
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
12741267 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12741221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 21159457 - 21159503
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
21159457 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 21159503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22155933 - 22155979
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
22155933 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 22155979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25610126 - 25610080
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
25610126 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 25610080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 28452151 - 28452197
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| |||||||||||||| |||||| |||||||    
28452151 aaaatatggttttggtccttgcaaatatgtcttgttttggttttagt 28452197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 30034468 - 30034422
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| || ||||||||||||||||||||| |||||||    
30034468 aaaatatggttttgctccttgcaaatatgtctcgttttggttttagt 30034422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32119224 - 32119270
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||||||  |||||||||||||||||||  |||||||    
32119224 aaaatatagttttggtccctgcaaatatgtctcgttttagttttagt 32119270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35569132 - 35569086
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35569132 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35569086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38232245 - 38232291
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||  ||||||||  ||||||||||||||||||||||||||||    
38232245 aaaatatgattttggtccctgcaaatatgtctcgttttgattttagt 38232291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 45005890 - 45005936
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||  ||||||||||||||||||||||||||||    
45005890 aaaatatggttttgatccctgcaaatatgtctcgttttgattttagt 45005936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 46622125 - 46622079
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| |||||||||||| |||||||| |||||||    
46622125 aaaatatggttttggtccttgcaaatatgtttcgttttggttttagt 46622079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 46901108 - 46901162
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||||| ||||| |||| ||||||||||| |||||||| ||||||||| |||||    
46901108 aaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgtaa 46901162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 47336577 - 47336531
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
47336577 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 47336531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 51550442 - 51550396
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
51550442 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 51550396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 277 - 323
Target Start/End: Complemental strand, 52956688 - 52956642
Alignment:
277 gttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    |||||||||| ||||||||||  |||||||| |||||||||||||||    
52956688 gttttggtctctgcaaatatgcatcgttttggttttagtttttgtaa 52956642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 54608859 - 54608813
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
54608859 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 54608813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 315
Target Start/End: Original strand, 25710515 - 25710560
Alignment:
270 aaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||| |||  ||||||||||||||||||||||||||||    
25710515 aaatatggttttagtccctgcaaatatgtctcgttttgattttagt 25710560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 35533283 - 35533328
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttag 314  Q
    ||||||| |||||||||| ||||||||||||| |||||| ||||||    
35533283 aaaatatggttttggtctctgcaaatatgtcttgttttggttttag 35533328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 277 - 313
Target Start/End: Complemental strand, 50009272 - 50009236
Alignment:
277 gttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||||| ||||||||||| |||||||||||||||    
50009272 gttttggtccttgcaaatatgcctcgttttgatttta 50009236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 31)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 39520726 - 39520680
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||||    
39520726 aaaatatggttttggtccttgcaaatatgtctcgttttgattttagt 39520680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 19005602 - 19005649
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||||||||||||||||  || ||||||||||||||||||||||||||    
19005602 aaaatatagttttggtccctgtaaatatgtctcgttttgattttagtt 19005649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 25547492 - 25547440
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| |||  ||||||||||||||||||||||||||||    
25547492 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 25547440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 44403251 - 44403199
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
44403251 ttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 44403199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 323
Target Start/End: Complemental strand, 48359077 - 48359017
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||| ||||||| ||||| |||  |||||||||||||||||||| |||||||| ||||||    
48359077 ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaa 48359017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 3807868 - 3807915
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||||||||||||   |||||||||||||||||||| ||||||||    
3807868 aaaatatagttttggttcctgcaaatatgtctcgttttggttttagtt 3807915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 252 - 315
Target Start/End: Original strand, 19783802 - 19783865
Alignment:
252 ttatatgatcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||  || ||| ||||||||||||| |||  |||||||||||||||||||| |||||||    
19783802 ttatatgaaaataggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 19783865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Complemental strand, 28529205 - 28529162
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttt 312  Q
    ||||||| |||||||||| |||||||||||||||||||| ||||    
28529205 aaaatatggttttggtctctgcaaatatgtctcgttttggtttt 28529162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 30352905 - 30352854
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||||||||| |||  |||||||||| |||||||||||||||||    
30352905 tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagt 30352854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 489068 - 489022
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||  |||| |||| ||||||||||||||||||||||||||||    
489068 aaaatatgattttagtctctgcaaatatgtctcgttttgattttagt 489022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1614563 - 1614609
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
1614563 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1614609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8144299 - 8144345
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
8144299 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8144345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 9659359 - 9659405
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||  ||||||||||||||||||||||||||||    
9659359 aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 9659405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 23399972 - 23399926
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
23399972 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 23399926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 23676136 - 23676182
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
23676136 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 23676182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25092164 - 25092210
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
25092164 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25092210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25988389 - 25988435
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
25988389 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25988435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26877682 - 26877728
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||| |||||||||||||||||||| |||||||    
26877682 aaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 26877728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27458403 - 27458449
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
27458403 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 27458449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 31503779 - 31503733
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
31503779 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 31503733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35104082 - 35104128
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||| ||||||||  |||||||||||||||||||| |||||||    
35104082 aaaatataattttggtccctgcaaatatgtctcgttttggttttagt 35104128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35837928 - 35837974
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35837928 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35837974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35838333 - 35838287
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35838333 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35838287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 43058754 - 43058800
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||||||| |||  ||||||||||||| ||||||||||||||    
43058754 aaaatatagttttagtccctgcaaatatgtcttgttttgattttagt 43058800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 46759662 - 46759708
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
46759662 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 46759708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 324
Target Start/End: Original strand, 6887174 - 6887219
Alignment:
279 tttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||||||| |||||| ||||||| ||||||||    
6887174 tttggtccttgcaaatatgtcttgttttggttttagtctttgtaat 6887219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 13769771 - 13769824
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| ||||| |||  |||||||||||||||||||| |||||||    
13769771 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 13769824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 38186370 - 38186415
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttag 314  Q
    ||||||| |||||||||  |||||||||| ||||||||||||||||    
38186370 aaaatatggttttggtccctgcaaatatgcctcgttttgattttag 38186415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 46304387 - 46304334
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||||||||| |||  ||||||||||| |||||||| |||||||    
46304387 attggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagt 46304334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 1559347 - 1559391
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||||||||| |||  |||||||||| |||||||||||||||    
1559347 aaaatatagttttagtccctgcaaatatgcctcgttttgatttta 1559391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 5308321 - 5308373
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| ||| ||||||||||||||||||||  |||||||    
5308321 ttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt 5308373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 24)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 15722614 - 15722660
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||| ||||||||||||||||||||||||||||    
15722614 aaaatatggttttggtctatgcaaatatgtctcgttttgattttagt 15722660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 14656256 - 14656210
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||||    
14656256 aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 14656210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 17765013 - 17765067
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||| |||||    
17765013 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaa 17765067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 18024015 - 18024061
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||||||||||||||| ||||||||| |||||||    
18024015 aaaatatggttttggtctttgcaaatatgcctcgttttggttttagt 18024061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 31276336 - 31276290
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||||||  ||||||||||||||||||||||||||||    
31276336 aaaataaagttttggtccctgcaaatatgtctcgttttgattttagt 31276290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 24901237 - 24901289
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
24901237 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24901289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 10910628 - 10910679
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||| | |||||||||||||||||| |||||||    
10910628 tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagt 10910679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 1214992 - 1214946
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||| |||||||||||||||||||| |||||||    
1214992 aaaatatggttttgatctctgcaaatatgtctcgttttggttttagt 1214946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 3276350 - 3276304
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
3276350 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3276304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 3968649 - 3968695
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
3968649 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3968695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 6412222 - 6412268
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
6412222 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 6412268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 6412575 - 6412529
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
6412575 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 6412529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 8170147 - 8170101
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
8170147 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8170101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10910960 - 10910914
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
10910960 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10910914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 12757614 - 12757660
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
12757614 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12757660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19690397 - 19690443
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
19690397 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19690443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 20467355 - 20467401
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||||||  |||||||||| ||||||||| |||||||    
20467355 aaaatatagttttggtccctgcaaatatgcctcgttttggttttagt 20467401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 21385255 - 21385301
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
21385255 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 21385301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 22543714 - 22543668
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
22543714 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 22543668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33131846 - 33131800
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||||||||||||||| ||||||||| |||||||    
33131846 aaaatatggttttagtctttgcaaatatgcctcgttttggttttagt 33131800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Original strand, 317816 - 317861
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttag 314  Q
    ||||||||||||| |||  |||||||||||||||||||| ||||||    
317816 aaaatatagttttagtccctgcaaatatgtctcgttttggttttag 317861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 278 - 315
Target Start/End: Original strand, 11925752 - 11925789
Alignment:
278 ttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||  ||||||||||||||||||||||||||||    
11925752 ttttggtccctgcaaatatgtctcgttttgattttagt 11925789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 307
Target Start/End: Complemental strand, 19690762 - 19690717
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttg 307  Q
    |||||| ||||||| |||||||||  ||||||||||||||||||||    
19690762 attggcgaaaatatggttttggtccctgcaaatatgtctcgttttg 19690717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 31167202 - 31167150
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| |||  |||||||||| |||||||||||||||||    
31167202 ttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagt 31167150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 35)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 28449210 - 28449166
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||    
28449210 aaaatatggttttggtccttgcaaatatgtctcgttttgatttta 28449166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 11693117 - 11693071
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  ||||||||||||||||||||||||||||    
11693117 aaaatatggttttggtccctgcaaatatgtctcgttttgattttagt 11693071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 47022744 - 47022790
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||||    
47022744 aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 47022790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 316
Target Start/End: Complemental strand, 47532667 - 47532621
Alignment:
270 aaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||||| ||||||||| ||||||||||||||||||||| ||||||||    
47532667 aaatatggttttggtccttgcaaatatgtctcgttttggttttagtt 47532621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 13073757 - 13073809
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
13073757 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13073809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 42824093 - 42824041
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  ||||||||||||| ||||||||||||||    
42824093 ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt 42824041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 52543426 - 52543470
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||    
52543426 aaaatatggttttggtccttgcaaatatgtctcgttttggtttta 52543470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Original strand, 12152283 - 12152314
Alignment:
331 tttttaaaaatcaaaagattttgcagagacta 362  Q
    ||||||||||||||||||||||||||||||||    
12152283 tttttaaaaatcaaaagattttgcagagacta 12152314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 45593582 - 45593535
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| ||||| |||| |||||||||||||||||||| ||||||||    
45593582 aaaatatggttttagtctctgcaaatatgtctcgttttggttttagtt 45593535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 53916043 - 53915996
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
53916043 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 53915996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 54208821 - 54208766
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||| | ||||||    
54208821 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat 54208766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5797485 - 5797531
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||  ||||||||| |||||||||||||||||||| |||||||    
5797485 aaaatatgattttggtctctgcaaatatgtctcgttttggttttagt 5797531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13530383 - 13530429
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| ||  ||||||||||||||||||||||||||||    
13530383 aaaatatggttttgctccctgcaaatatgtctcgttttgattttagt 13530429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13631232 - 13631278
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
13631232 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13631278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 14791802 - 14791756
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
14791802 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 14791756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 15555634 - 15555588
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||||||||| |||  |||||||||||||||||||| |||||||    
15555634 aaaatatagttttagtccctgcaaatatgtctcgttttggttttagt 15555588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19903265 - 19903311
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||| ||  |||||||||||||| |||||||||||||    
19903265 aaaatatagttttgatccctgcaaatatgtctcattttgattttagt 19903311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 19903651 - 19903605
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
19903651 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19903605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 22584291 - 22584337
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
22584291 aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 22584337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25423928 - 25423974
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
25423928 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25423974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25424308 - 25424262
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
25424308 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25424262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 29420533 - 29420487
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
29420533 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 29420487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 35420699 - 35420653
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| |||||||||||||||| |||| |||||||    
35420699 aaaatatggttttggtccttgcaaatatgtctcgatttggttttagt 35420653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 35464022 - 35464068
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
35464022 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35464068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 36702004 - 36702050
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
36702004 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 36702050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 43231092 - 43231138
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
43231092 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 43231138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 52441767 - 52441813
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
52441767 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 52441813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 52442088 - 52442042
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
52442088 aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 52442042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 53915687 - 53915733
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
53915687 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 53915733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 362
Target Start/End: Complemental strand, 4211713 - 4211680
Alignment:
329 catttttaaaaatcaaaagattttgcagagacta 362  Q
    |||||||||||||||||||||||||||| |||||    
4211713 catttttaaaaatcaaaagattttgcagggacta 4211680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 19321862 - 19321809
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  ||||||||||| |||||||| |||||||    
19321862 attggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagt 19321809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 5827653 - 5827705
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||| ||||| |||||||    
5827653 ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt 5827705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 8904890 - 8904934
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    |||||||||||||||||  |||||||||| ||||||||| |||||    
8904890 aaaatatagttttggtccctgcaaatatgcctcgttttggtttta 8904934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 28809009 - 28809061
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| ||| |||||||||||| |||||||| |||||||    
28809009 ttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagt 28809061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 47274232 - 47274180
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||||||||| ||   |||||||||||||||||||| |||||||    
47274232 ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 47274180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 33)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 4736209 - 4736247
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttg 307  Q
    ||||||| |||||||||||||||||||||||||||||||    
4736209 aaaatatggttttggtctttgcaaatatgtctcgttttg 4736247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 262 - 316
Target Start/End: Original strand, 36973350 - 36973404
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||||| ||||||| |||||||||| | |||||||||||||||||| ||||||||    
36973350 attggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagtt 36973404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 37271702 - 37271656
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  ||||||||||||||||||||||||||||    
37271702 aaaatatggttttggtccctgcaaatatgtctcgttttgattttagt 37271656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 35928461 - 35928408
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
35928461 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35928408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 38452392 - 38452348
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| |||||||||  ||||||||||||||||||||||||||    
38452392 aaaatatggttttggtccctgcaaatatgtctcgttttgatttta 38452348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 45137 - 45188
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
45137 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 45188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Complemental strand, 12145179 - 12145136
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttt 312  Q
    ||||||| |||||||||  |||||||||||||||||||||||||    
12145179 aaaatatggttttggtccctgcaaatatgtctcgttttgatttt 12145136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Original strand, 20690737 - 20690792
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||| | ||||||    
20690737 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaat 20690792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Complemental strand, 28213583 - 28213552
Alignment:
331 tttttaaaaatcaaaagattttgcagagacta 362  Q
    ||||||||||||||||||||||||||||||||    
28213583 tttttaaaaatcaaaagattttgcagagacta 28213552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 35609633 - 35609586
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
35609633 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt 35609586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1104862 - 1104908
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
1104862 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 1104908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 1381251 - 1381297
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
1381251 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 1381297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4203766 - 4203720
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
4203766 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 4203720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5614170 - 5614216
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
5614170 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 5614216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5904012 - 5904058
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||| || ||||||||||| |||||||||||||||||    
5904012 aaaatatggttttgctccttgcaaatatgcctcgttttgattttagt 5904058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 5917130 - 5917176
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
5917130 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 5917176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 6912853 - 6912807
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
6912853 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 6912807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10744050 - 10744004
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
10744050 aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 10744004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 14318049 - 14318095
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
14318049 aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 14318095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 18046042 - 18046088
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
18046042 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 18046088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 18258523 - 18258477
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
18258523 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 18258477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19565471 - 19565517
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
19565471 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19565517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19685021 - 19685067
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
19685021 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19685067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20418012 - 20417966
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||  |||| ||||||||||||||||||||||||||||    
20418012 aaaatatggtttaagtctctgcaaatatgtctcgttttgattttagt 20417966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20986085 - 20986039
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
20986085 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 20986039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 316
Target Start/End: Complemental strand, 29366952 - 29366898
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||||| ||||||| ||||| |||  |||||||||||||||||||| ||||||||    
29366952 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtt 29366898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 30888164 - 30888210
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
30888164 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 30888210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 36973706 - 36973660
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  || |||||||||||||||||||||||||    
36973706 aaaatatggttttggtccctggaaatatgtctcgttttgattttagt 36973660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Complemental strand, 35877048 - 35877003
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttag 314  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||    
35877048 aaaatatggttttggtccctgcaaatatgtctcgttttggttttag 35877003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 2636667 - 2636719
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||| ||||||||||| |||||||    
2636667 ttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt 2636719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 324
Target Start/End: Complemental strand, 5104002 - 5103942
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    |||| ||||||| ||||||||   |||||||||||||| ||||| ||||||||| ||||||    
5104002 tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgtaat 5103942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 323
Target Start/End: Original strand, 38962804 - 38962864
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||| ||||||| ||||| |||  || ||||||||||||||||| |||||||| ||||||    
38962804 ttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgtaa 38962864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 324
Target Start/End: Original strand, 42553641 - 42553701
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    |||| |||||||  ||||||||  |||||||||||||||||||| ||||||| | ||||||    
42553641 tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaat 42553701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 36)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26207282 - 26207328
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||||    
26207282 aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 26207328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 32420102 - 32420148
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||||    
32420102 aaaatatggttttggtccttgcaaatatgtctcgttttggttttagt 32420148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 32906236 - 32906190
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||  |||||||| |||||||||||||||||||||||||||||    
32906236 aaaatatgattttggtccttgcaaatatgtctcgttttgattttagt 32906190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 10631161 - 10631214
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
10631161 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10631214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 24977775 - 24977828
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
24977775 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 24977828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 40718108 - 40718160
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
40718108 ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 40718160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 49073695 - 49073739
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||||||| ||||||||||||||||||||| |||||    
49073695 aaaatatggttttggtccttgcaaatatgtctcgttttggtttta 49073739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 262 - 313
Target Start/End: Complemental strand, 12322973 - 12322922
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||    
12322973 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta 12322922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 24978118 - 24978071
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||||||||||||| | ||||||||| ||||||||| ||||||||    
24978118 aaaatatagttttggtcctggcaaatatgcctcgttttggttttagtt 24978071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 35056529 - 35056580
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
35056529 tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 35056580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 312
Target Start/End: Original strand, 39025113 - 39025156
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttt 312  Q
    ||||||| |||||||||  |||||||||||||||||||||||||    
39025113 aaaatatggttttggtccctgcaaatatgtctcgttttgatttt 39025156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 3247202 - 3247248
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
3247202 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 3247248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 4789312 - 4789358
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
4789312 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4789358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 7818786 - 7818840
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||||||||||| |||  |||||||||| ||||||||| ||||||||| |||||    
7818786 aaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgtaa 7818840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8140438 - 8140484
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
8140438 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 8140484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 10887594 - 10887548
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
10887594 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 10887548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 12360964 - 12360918
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
12360964 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 12360918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 15526358 - 15526312
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
15526358 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 15526312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 19720716 - 19720762
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
19720716 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 19720762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 22674207 - 22674261
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaa 323  Q
    ||||||| |||| ||||  |||||||||||||||||||| ||||||| |||||||    
22674207 aaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtctttgtaa 22674261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 27521580 - 27521626
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
27521580 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 27521626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 30322933 - 30322979
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
30322933 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 30322979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 33000309 - 33000355
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||| |||||||||||||||||    
33000309 aaaatatggttttggtccctgcaaatatgcctcgttttgattttagt 33000355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33000665 - 33000619
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
33000665 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 33000619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 38150852 - 38150898
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
38150852 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 38150898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 39747831 - 39747785
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
39747831 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 39747785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 45380276 - 45380322
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
45380276 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 45380322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 324
Target Start/End: Original strand, 12322602 - 12322663
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||| ||||||| |||||| ||  ||||||||||| ||||||||||||||||  |||||||    
12322602 ttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaat 12322663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 269 - 314
Target Start/End: Complemental strand, 24654163 - 24654118
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttag 314  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||    
24654163 aaaatatggttttggtccctgcaaatatgtctcgttttggttttag 24654118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 17130079 - 17130035
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||    
17130079 aaaatatggttttggtccctgcaaatatgtctcgttttggtttta 17130035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 31060785 - 31060837
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| |||||||||  ||||||||||||| |||||| |||||||    
31060785 ttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagt 31060837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 271 - 315
Target Start/End: Original strand, 32035442 - 32035486
Alignment:
271 aatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| |||||| ||| |||||||||||||||||||| |||||||    
32035442 aatatggttttgatctctgcaaatatgtctcgttttggttttagt 32035486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 33067726 - 33067682
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||    
33067726 aaaatatcgttttagtccttgcaaatatgtctcgttttggtttta 33067682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Complemental strand, 45638890 - 45638846
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||    
45638890 aaaatatggttttggtccctgcaaatatgtctcgttttggtttta 45638846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 50428877 - 50428921
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||    
50428877 aaaatatggttttagtccttgcaaatatgtctcgttttgctttta 50428921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 52254481 - 52254429
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| |||  |||||||||| |||||||||||||||||    
52254481 ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt 52254429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 33)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 262 - 315
Target Start/End: Original strand, 42695865 - 42695918
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
42695865 attggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 42695918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Original strand, 1497608 - 1497660
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||| ||||| ||| ||||||||||| |||||||||||||||||    
1497608 ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagt 1497660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 313
Target Start/End: Original strand, 45442320 - 45442364
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgatttta 313  Q
    ||||||| ||||| |||| ||||||||||||||||||||||||||    
45442320 aaaatatggttttagtctctgcaaatatgtctcgttttgatttta 45442364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 260 - 315
Target Start/End: Original strand, 11713480 - 11713535
Alignment:
260 tcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||| ||||||| ||||| |||  |||||||||||||||||||| |||||||    
11713480 tcattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 11713535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 19831512 - 19831559
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| ||||| |||||||||||||||| |||||||| ||||||||    
19831512 aaaatatggttttagtctttgcaaatatgtttcgttttggttttagtt 19831559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 260 - 315
Target Start/End: Original strand, 26813861 - 26813916
Alignment:
260 tcattggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||| ||||||| ||||| |||  |||||||||||||||||||| |||||||    
26813861 tcattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 26813916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 331 - 362
Target Start/End: Complemental strand, 29831999 - 29831968
Alignment:
331 tttttaaaaatcaaaagattttgcagagacta 362  Q
    ||||||||||||||||||||||||||||||||    
29831999 tttttaaaaatcaaaagattttgcagagacta 29831968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Original strand, 31225719 - 31225766
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||||||||| |||  |||||||||| ||||||||||||||||||    
31225719 aaaatatagttttagtccctgcaaatatgcctcgttttgattttagtt 31225766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 36806897 - 36806846
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  |||||||||||||||||||| |||||||    
36806897 tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 36806846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 316
Target Start/End: Complemental strand, 36815831 - 36815784
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    ||||||| |||||||||  |||||||||||||||||||| ||||||||    
36815831 aaaatatggttttggtccatgcaaatatgtctcgttttggttttagtt 36815784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 37229038 - 37228983
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| |||||||||  ||||||||| | |||||||| ||||||||||||||||    
37229038 aaaatatggttttggtccctgcaaatatatttcgttttggttttagtttttgtaat 37228983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 2481197 - 2481243
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||||||  ||||||||||||||||||||| |||||||    
2481197 aaaatatggttttggtacttgcaaatatgtctcgttttggttttagt 2481243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 4424181 - 4424135
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
4424181 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 4424135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13215064 - 13215110
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
13215064 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 13215110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 13850526 - 13850572
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||||||||||| ||| ||||||||||||||| |||| |||||||    
13850526 aaaatatagttttgatctctgcaaatatgtctcgatttggttttagt 13850572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 20131321 - 20131367
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
20131321 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20131367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 20939321 - 20939275
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
20939321 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 20939275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 23990192 - 23990146
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||||||||||||| |||||||    
23990192 aaaatatggttttagtccttgcaaatatgtctcgttttggttttagt 23990146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 25705089 - 25705135
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
25705089 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 25705135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 25954422 - 25954376
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| ||| ||||||||||| |||||||||||||||||    
25954422 aaaatatggttttagtccttgcaaatatgcctcgttttgattttagt 25954376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 26238817 - 26238863
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
26238817 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 26238863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 26239156 - 26239110
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
26239156 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 26239110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 31644845 - 31644891
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
31644845 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 31644891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 33576113 - 33576067
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
33576113 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 33576067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 324
Target Start/End: Complemental strand, 34318086 - 34318024
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    |||||| ||||||| |||||||||  | |||||||| |||||||||||||||||  |||||||    
34318086 attggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaat 34318024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 41451841 - 41451887
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
41451841 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 41451887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 44559066 - 44559112
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
44559066 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 44559405 - 44559359
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
44559405 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 44559359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 4042893 - 4042840
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| |||| ||||  |||||||||||||||||||| |||||||    
4042893 attggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt 4042840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 315
Target Start/End: Complemental strand, 5790902 - 5790849
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||||| ||||||| ||||| |||  |||||||||||||||||||| |||||||    
5790902 attggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt 5790849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 316
Target Start/End: Original strand, 9195053 - 9195105
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagtt 316  Q
    |||| ||||||| ||||| |||  |||||||||||||||||||| ||||||||    
9195053 tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtt 9195105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 306
Target Start/End: Complemental strand, 34964162 - 34964118
Alignment:
262 attggcaaaaatatagttttggtctttgcaaatatgtctcgtttt 306  Q
    |||||| ||||||| |||||||||  |||||||||||||||||||    
34964162 attggctaaaatatggttttggtccctgcaaatatgtctcgtttt 34964118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 330 - 362
Target Start/End: Complemental strand, 38231642 - 38231610
Alignment:
330 atttttaaaaatcaaaagattttgcagagacta 362  Q
    ||||||||||||||||||||||||||| |||||    
38231642 atttttaaaaatcaaaagattttgcagggacta 38231610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 269 - 324
Target Start/End: Complemental strand, 8638 - 8583
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagtttttgtaat 324  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||  |||||||    
8638 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaat 8583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 8334 - 8380
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| ||||| |||  ||||||||||||||||||||||||||||    
8334 aaaatatggttttagtccctgcaaatatgtctcgttttgattttagt 8380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 315
Target Start/End: Complemental strand, 2884 - 2833
Alignment:
264 tggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    |||| ||||||| |||||||||  ||||||||||||||||||||| ||||||    
2884 tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagt 2833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 27360 - 27314
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
27360 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 27314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold0056
Description:

Target: scaffold0056; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 50074 - 50028
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
50074 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 50028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0056; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 55175 - 55129
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
55175 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 55129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Original strand, 47929 - 47975
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
47929 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 47975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 269 - 315
Target Start/End: Complemental strand, 148278 - 148232
Alignment:
269 aaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||||| |||||||||  |||||||||||||||||||| |||||||    
148278 aaaatatggttttggtccctgcaaatatgtctcgttttggttttagt 148232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 3457 - 3405
Alignment:
263 ttggcaaaaatatagttttggtctttgcaaatatgtctcgttttgattttagt 315  Q
    ||||| ||||||||||||| ||   |||||||||||||||||||| |||||||    
3457 ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt 3405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University