View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_low_11 (Length: 400)
Name: NF0710_low_11
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0710_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 123 - 391
Target Start/End: Original strand, 29879758 - 29880026
Alignment:
| Q |
123 |
taaattaaattcaaactcgatcccatgatttaattaaaagagtcttccaatcatattttatcctagcacttttgggtatgtaggggcttcctatgtacca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29879758 |
taaattaaattcaaactcgatcccatgatttaattaaaagagtattccaatcatattttatcctagcacttttgggtatgtaggggcttcctatgtacca |
29879857 |
T |
|
| Q |
223 |
ttgaatatatcgcatgttataattaatattcaatttaattatacgttgacatgaaagttacctaaaaatatcaaaacttataataaacatttattcccat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29879858 |
ttgaatatatcgcatgttataattaatattcaatttaattatacgttgacatgaaagttacctaaaaatatcaaaacttataataaacatttattcccat |
29879957 |
T |
|
| Q |
323 |
acacccnnnnnnnaatttcttttatgaaaaatatgaaggtcggaatcattgttctcagtttagaataat |
391 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29879958 |
acaccctttttttaatttcttttatgaaaaatatgaaggtcagaatcattgttctcagtttagaataat |
29880026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 29879583 - 29879632
Alignment:
| Q |
1 |
caaagctcgaagcttgtttttgatactggccttattatttatgagtcccca |
51 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
29879583 |
caaagctcggagcttctttt-gatactggccttattatttatgagtcccca |
29879632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 358 times since January 2019
Visitors: 4379