View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_low_20 (Length: 243)
Name: NF0710_low_20
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0710_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 15 - 134
Target Start/End: Original strand, 44166658 - 44166777
Alignment:
Q |
15 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44166658 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
44166757 |
T |
 |
Q |
115 |
tcccagatctctgctcctcc |
134 |
Q |
|
|
|||||||||| |||| |||| |
|
|
T |
44166758 |
tcccagatctgtgcttctcc |
44166777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 4379