View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0710_low_20 (Length: 243)

Name: NF0710_low_20
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0710_low_20
NF0710_low_20
[»] chr4 (1 HSPs)
chr4 (15-134)||(44166658-44166777)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 15 - 134
Target Start/End: Original strand, 44166658 - 44166777
Alignment:
15 atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44166658 atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa 44166757  T
115 tcccagatctctgctcctcc 134  Q
    |||||||||| |||| ||||    
44166758 tcccagatctgtgcttctcc 44166777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 310 times since January 2019
Visitors: 4379