View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0710_low_21 (Length: 243)
Name: NF0710_low_21
Description: NF0710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0710_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 15 - 134
Target Start/End: Original strand, 44166658 - 44166777
Alignment:
| Q |
15 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166658 |
atcaaattaccattttcacctttttcagataccaatattgatctatcacatgcaccggaatacaaaaccgaaccgtcactgttaagagccaatgcattaa |
44166757 |
T |
 |
| Q |
115 |
tcccagatctgtgctcctcc |
134 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
44166758 |
tcccagatctgtgcttctcc |
44166777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University