View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_high_11 (Length: 335)
Name: NF0711_high_11
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0711_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 39044818 - 39045053
Alignment:
Q |
1 |
ctagaatagccttcaccatggattgggcggttacgagattggttgatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39044818 |
ctagaatagccttcaccatggattgggcggttacgagattggtagatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggag |
39044917 |
T |
 |
Q |
101 |
attggcgagtgatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagta |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39044918 |
attggcgagtgatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagta |
39045017 |
T |
 |
Q |
201 |
ggttggtggtgattgtggttgtgatggtgagtggcg |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
39045018 |
ggttggtggtgattgtggttgtgatggtgagtggcg |
39045053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 216
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
Q |
141 |
gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt |
216 |
Q |
|
|
||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || ||||| || ||||||| |||| |
|
|
T |
40022292 |
gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt |
40022367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University