View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0711_high_11 (Length: 335)

Name: NF0711_high_11
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0711_high_11
NF0711_high_11
[»] chr8 (1 HSPs)
chr8 (1-236)||(39044818-39045053)
[»] chr7 (1 HSPs)
chr7 (141-216)||(40022292-40022367)


Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 39044818 - 39045053
Alignment:
1 ctagaatagccttcaccatggattgggcggttacgagattggttgatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044818 ctagaatagccttcaccatggattgggcggttacgagattggtagatgagaggttgatggccgattggatgagttggagagcggtgggatttggagggag 39044917  T
101 attggcgagtgatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39044918 attggcgagtgatgattcgcattgttgtgggaatcgggttgctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagta 39045017  T
201 ggttggtggtgattgtggttgtgatggtgagtggcg 236  Q
    ||||||||||||||||||||||||||||||||||||    
39045018 ggttggtggtgattgtggttgtgatggtgagtggcg 39045053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 216
Target Start/End: Original strand, 40022292 - 40022367
Alignment:
141 gctttgcaggcttgttggatctctgacccggcggtgggagaaacggagggggagggagtaggttggtggtgattgt 216  Q
    ||||||||||||||||| ||||| ||| |||| |||||| |||||||||| || |||||  || ||||||| ||||    
40022292 gctttgcaggcttgttgaatctccgacgcggccgtgggataaacggagggagaaggagtgcgtgggtggtggttgt 40022367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 332 times since January 2019
Visitors: 4379