View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_high_14 (Length: 316)
Name: NF0711_high_14
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_high_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 29865572 - 29865887
Alignment:
| Q |
1 |
tgatatacaggatgatgatgctgcatcacaggcagtagttgcgtgagtcttctccaatctttgcactttctagattaattacattttattgtttacgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29865572 |
tgatatacaggatgatgatgctgcatcacaggcagtagttgcgtgagtcttctccaatctttgcactttctagattaattgcattttattgtttacgtga |
29865671 |
T |
|
| Q |
101 |
tgcaaattgctattttataaatccgattttatgtttggtttagcttgggatgaaattctggtgattttttgtgttaatgttctatgcatgtgttagattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865672 |
tgcaaattgctattttataaatccgattttatgtttggtttagcttgggatgaaattctggtgattttttgtgttaatgttctatgcatgtgttagattt |
29865771 |
T |
|
| Q |
201 |
cgatttagggtttaattttgtcaagattttcaattagtaaaaaggaaaatgatatattggacttgaatttggctatacaaaacttccaagggtaaatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865772 |
cgatttagggtttaattttgtcaagattttcaattagtaaaaaggaaaatgatatattggacttgaatttggctatacaaaacttccaagggtaaatttt |
29865871 |
T |
|
| Q |
301 |
atccaaggttctaaaa |
316 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
29865872 |
atccaaggctctaaaa |
29865887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 370 times since January 2019
Visitors: 4379