View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_high_18 (Length: 251)
Name: NF0711_high_18
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] scaffold0559 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 40783079 - 40782859
Alignment:
| Q |
30 |
aatttaactaagatattttcgatctaagagtgagca-taaattaaaggaggaaacatgatgaggttgtgttgtttgtgagcatgcgcacacatacacatg |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40783079 |
aatttaactaagatattttctatctaagagtgagcaataaattaaaggaggaaacatgatgaggttgtgttgtttgtgagcatgcgcacacataca--tg |
40782982 |
T |
|
| Q |
129 |
atacatagattagagacatgaaattgaaaggcaatatagtgaagaaggtggtcacgtgaagatggtcgaccccatcgtccattatctaccatataggcca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40782981 |
atacatagattagagacatgaaattgaaaggcaatatagtgaagaaggtggtcacgtgaagatggtcgaccccatcatccattatctaccatataggcca |
40782882 |
T |
|
| Q |
229 |
tagcacagtgatactcacaagaa |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40782881 |
tagcacagtgatactcacaagaa |
40782859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0559 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0559
Description:
Target: scaffold0559; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 10990 - 10920
Alignment:
| Q |
181 |
cacgtgaagatggtcgaccccatcgtccattatctaccatataggccatagcacagtgatactcacaagaa |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10990 |
cacgtgaagatggtcgaccccatcatccattatctaccatataggccatagcacagtgatactcacaagaa |
10920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 821 times since January 2019
Visitors: 4393