View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_low_12 (Length: 375)
Name: NF0711_low_12
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 363
Target Start/End: Original strand, 42183105 - 42183439
Alignment:
| Q |
29 |
acatttctgcctccaacacaaccctcaaaggttaatttgtgtttatttcttattgttttccatcaatcaataatatatagaaaaataagtagtgatcaga |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
42183105 |
acatttctgcctccaacacaaccctcaaaggttaatttgtgtttatttcttattgttttccatcaatcaataatatatagaaacataagtagtggtcaga |
42183204 |
T |
|
| Q |
129 |
acnnnnnnngttctgtacaagtttctgaagtctgaacatacttgtgtttgttgttgtcacagcaggtggaatggcggcttcaataggaatagggtatcct |
228 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183205 |
acaaaaaaagttctgtacaagtttctgaagtctgaacatacttgtgtttgtggttgtcacagcaggtggaatggcggcttcaataggaatagggtatcct |
42183304 |
T |
|
| Q |
229 |
cctttcacaagtgctcaatggagagagcttgaaagacaagctatgatttacaagtacttgatggcttcacttcctgttccttctcatcttctttcatgta |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183305 |
cctttcacaagtgctcaatggagagagcttgaaagacaagctatgatttacaagtacttgatggcttcacttcctgttccttctcatcttctttcatgta |
42183404 |
T |
|
| Q |
329 |
tggcccttttctctcttcttccttaatttcatatt |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183405 |
tggcccttttctctcttcttccttaatttcatatt |
42183439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1231 times since January 2019
Visitors: 4365