View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_low_14 (Length: 343)
Name: NF0711_low_14
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_low_14 |
 | |
|
| [»] scaffold0245 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0245 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 290
Target Start/End: Complemental strand, 18948 - 18894
Alignment:
| Q |
236 |
accttggaagtatggcttacctgaaaaacttccactcccctcgttgacaatcacc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
18948 |
accttggaagtatggcttacctgaaaaacttccactcctcacgtggacaatcacc |
18894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 290
Target Start/End: Complemental strand, 1292541 - 1292487
Alignment:
| Q |
236 |
accttggaagtatggcttacctgaaaaacttccactcccctcgttgacaatcacc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
1292541 |
accttggaagtatggcttacctgaaaaacttccactcctcacgtggacaatcacc |
1292487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1378 times since January 2019
Visitors: 4368