View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_low_20 (Length: 313)
Name: NF0711_low_20
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 28 - 219
Target Start/End: Complemental strand, 49180511 - 49180320
Alignment:
| Q |
28 |
catgaatagtatgcatagtgaacgaaaggaagatcaaacaaaacacagacacagtctcaaacctgacttccagccctgtagcagcaaactcatcttatac |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180511 |
catgaatagtatgcatagtgaacgaaaggaagatcaaacaaaacacagacacagtctcaaacctgacttccagccctgtagcagcaaactcatcttatac |
49180412 |
T |
 |
| Q |
128 |
gtggcatatagccatttttgtaagtcactgcattaaacaaagaatttaacaggaatccttccccgcgttcaatagcaactagcagcattttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180411 |
gtggcatatagccatttttgtaagtcactgcattgaacaaagaatttaacaggaatccttccccgcgttcaatagcaactagcagcattttc |
49180320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 214 - 301
Target Start/End: Complemental strand, 49180247 - 49180160
Alignment:
| Q |
214 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgaccta |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180247 |
attttcccacaaaagttaacaattatgtagttgtcaaccatgcaataggtgaaggacaaatttagtgattttcacctttaatgaccta |
49180160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University