View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0711_low_21 (Length: 287)

Name: NF0711_low_21
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0711_low_21
NF0711_low_21
[»] chr3 (2 HSPs)
chr3 (88-204)||(54941757-54941873)
chr3 (225-258)||(54941697-54941730)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 88 - 204
Target Start/End: Complemental strand, 54941873 - 54941757
Alignment:
88 tggtttggtgggataagaaagaa----ggaagaaatagtgtagcacggggcagcggcttttgggggcaagcaagcatcagctcaacatgaacatgagtag 183  Q
    |||||||||||||||||||||||    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||   |  ||||     
54941873 tggtttggtgggataagaaagaaagaaggaagaaatagtgtagcacggggcagcggctttt-ggggcaagcaagcatcagctcaacatg---agtagtac 54941778  T
184 tagttgagaaagcttgtttct 204  Q
    |||||||||||||||||||||    
54941777 tagttgagaaagcttgtttct 54941757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 258
Target Start/End: Complemental strand, 54941730 - 54941697
Alignment:
225 ggagaatcggttttggattagatggcgttgtaca 258  Q
    ||||||||||||||||||||||||||||||||||    
54941730 ggagaatcggttttggattagatggcgttgtaca 54941697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University