View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_low_21 (Length: 287)
Name: NF0711_low_21
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 88 - 204
Target Start/End: Complemental strand, 54941873 - 54941757
Alignment:
| Q |
88 |
tggtttggtgggataagaaagaa----ggaagaaatagtgtagcacggggcagcggcttttgggggcaagcaagcatcagctcaacatgaacatgagtag |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||| |
|
|
| T |
54941873 |
tggtttggtgggataagaaagaaagaaggaagaaatagtgtagcacggggcagcggctttt-ggggcaagcaagcatcagctcaacatg---agtagtac |
54941778 |
T |
|
| Q |
184 |
tagttgagaaagcttgtttct |
204 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
54941777 |
tagttgagaaagcttgtttct |
54941757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 258
Target Start/End: Complemental strand, 54941730 - 54941697
Alignment:
| Q |
225 |
ggagaatcggttttggattagatggcgttgtaca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
54941730 |
ggagaatcggttttggattagatggcgttgtaca |
54941697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 253 times since January 2019
Visitors: 4374