View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0711_low_23 (Length: 267)
Name: NF0711_low_23
Description: NF0711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0711_low_23 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0011 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 7 - 267
Target Start/End: Complemental strand, 240796 - 240536
Alignment:
| Q |
7 |
tcgaagaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240796 |
tcgaaaaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg |
240697 |
T |
|
| Q |
107 |
caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240696 |
caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag |
240597 |
T |
|
| Q |
207 |
agtgtaacacctaaatttgaaagcaaagtaaaatggatttaatttttatacaccggaaaac |
267 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240596 |
agtgtaacacctaaatgtgaaagcaaagtaaaatggatttaatttttatacaccggaaaac |
240536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 969 times since January 2019
Visitors: 4362