View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0712_high_12 (Length: 319)
Name: NF0712_high_12
Description: NF0712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0712_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 73 - 305
Target Start/End: Original strand, 17291368 - 17291602
Alignment:
| Q |
73 |
ctcaacattcgaactcatcacaattagatgggacctagttagtgatgtaacagaatcagttagtgaggagaccgaattagttagctagtattttaatcct |
172 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17291368 |
ctcaacatttcaactcatcacgattagatgggacctagttagtgatgtaacagaatcagttagtgaggaaaccgaattagttagctagtattttaatccc |
17291467 |
T |
|
| Q |
173 |
tcttaatttgtgattgtttctccgcaagtatataaggacaagcatgtgtaataactcattcatacaggttatcaatgaatcttctatctcaat--tctga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17291468 |
tcttaatttgtgattgtttctccgcaagtatataaggacaagcatgtgtaataactcattcatacaggttatcaatgaatcttctatctcaattctctga |
17291567 |
T |
|
| Q |
271 |
gttagagcttttctttcagtttcatcttcaacgtt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
17291568 |
gttagagcttttctttcagtttcatcttcatcgtt |
17291602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 17291257 - 17291328
Alignment:
| Q |
1 |
tttactaatgccttgtaccctaaacctttcaccaatctagcttccaagctgaacatgatatacatttaccaa |
72 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17291257 |
tttactaaagccttgtaccctaaacctttcaccaatctagcttccaagctgaacttgatatacatttaccaa |
17291328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 788 times since January 2019
Visitors: 4393