View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0712_high_6 (Length: 399)
Name: NF0712_high_6
Description: NF0712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0712_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 30 - 164
Target Start/End: Complemental strand, 21832931 - 21832797
Alignment:
| Q |
30 |
ggttttgcgaagtcgtgaaaactgtagaaactgtgaacacaaaaagacggtaacgttggtgcaaaaatggtgctggcggtgacacaaaaatattagggtt |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832931 |
ggttttgcgaagtcgtgaaaactgcagaaaccgtgaacacaaaaagacggtaacgttagtgcaaaaatggtgctggcggtgacacaaaaatattagggtt |
21832832 |
T |
|
| Q |
130 |
tggagttaggttatgtttttattgttacgggtttg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832831 |
tggagttaggttatgtttttattgttacgggtttg |
21832797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 170 - 265
Target Start/End: Complemental strand, 21832497 - 21832402
Alignment:
| Q |
170 |
ggtaacggatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832497 |
ggtaacagatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
21832402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 322 - 384
Target Start/End: Complemental strand, 21832347 - 21832285
Alignment:
| Q |
322 |
acataaaattcaacttcattcaattaggaaatggattatcggcaacacttatttctccacact |
384 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21832347 |
acataaaattcaacttcattcaattgggaaatggattatcggcaacacttatttctccacact |
21832285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 742 times since January 2019
Visitors: 4390