View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0712_low_2 (Length: 713)
Name: NF0712_low_2
Description: NF0712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0712_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 2e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 2e-57
Query Start/End: Original strand, 534 - 686
Target Start/End: Complemental strand, 41082660 - 41082501
Alignment:
Q |
534 |
gcagctgcacatgcctgaacccaactttattttttacatttgtgaaaatagacatcgacctag-------tataagatgaaacatacaatttttaatgtc |
626 |
Q |
|
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
41082660 |
gcagctgcacatgcctgaccccaacttgattttttacatttgtgaaaatagacatcgacctaggtcctagtataagatgaaatatacaatttttaatgtc |
41082561 |
T |
 |
Q |
627 |
tacccttaaacgaccgggtccatactatatatcactgtataaactattatacttgttctc |
686 |
Q |
|
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
41082560 |
tacctttaaacgaccgggtccatattatatatcactgtataaactattatacttgttctc |
41082501 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 488 - 536
Target Start/End: Complemental strand, 41088742 - 41088694
Alignment:
Q |
488 |
ttagttgtgaatgaaaattgtaggtttgtcacatgtatttatacacgca |
536 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41088742 |
ttagttgtgaatgaaaattgtaggtttgtcacatgtatttatacacgca |
41088694 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 41810490 - 41810548
Alignment:
Q |
238 |
tttgaatcttctagatggtaattatttatgtgttggctcagttcattcaaggttttgcc |
296 |
Q |
|
|
||||||||||||||||||||| |||| | |||||| ||||||||||| ||||||||| |
|
|
T |
41810490 |
tttgaatcttctagatggtaaccatttttatgttggaccagttcattcagggttttgcc |
41810548 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University