View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0712_low_29 (Length: 246)
Name: NF0712_low_29
Description: NF0712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0712_low_29 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 23663954 - 23664193
Alignment:
Q |
7 |
catatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggcgta |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23663954 |
catatggggtttcaaattggtattggtaatggtaactcaacttctgtttctgtttctgcttcttctgttgctggaggtgtcggagttgaaccatggcgta |
23664053 |
T |
 |
Q |
107 |
atttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatccatatacttttcaaggagaaagtaatattgaagctgctgcagc |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23664054 |
atttgcagcaatttcctttcttgaatactttcgaatcaaactcttctggaaataatccatatacttttcaaggagaaagtaatattgaagctgctgcagc |
23664153 |
T |
 |
Q |
207 |
atctggatttgttagagatatagcttcaaactctagggct |
246 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23664154 |
atctggatttgttagagatatagcttcaaactctagggct |
23664193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University