View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713-Insertion-12 (Length: 45)

Name: NF0713-Insertion-12
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713-Insertion-12
NF0713-Insertion-12
[»] chr4 (2 HSPs)
chr4 (8-41)||(30612315-30612348)
chr4 (8-39)||(30594969-30595000)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.00000000004; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 30612348 - 30612315
Alignment:
8 gatttcactcattggattccatctttaaccaaac 41  Q
    ||||||||||||||||||||||||||||||||||    
30612348 gatttcactcattggattccatctttaaccaaac 30612315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 30595000 - 30594969
Alignment:
8 gatttcactcattggattccatctttaaccaa 39  Q
    ||||||||||||||||||||||||||||||||    
30595000 gatttcactcattggattccatctttaaccaa 30594969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University