View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713-Insertion-12 (Length: 45)
Name: NF0713-Insertion-12
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713-Insertion-12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.00000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 41
Target Start/End: Complemental strand, 30612348 - 30612315
Alignment:
| Q |
8 |
gatttcactcattggattccatctttaaccaaac |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30612348 |
gatttcactcattggattccatctttaaccaaac |
30612315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 39
Target Start/End: Complemental strand, 30595000 - 30594969
Alignment:
| Q |
8 |
gatttcactcattggattccatctttaaccaa |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30595000 |
gatttcactcattggattccatctttaaccaa |
30594969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University