View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713-Insertion-6 (Length: 326)
Name: NF0713-Insertion-6
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713-Insertion-6 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 8 - 326
Target Start/End: Complemental strand, 1020122 - 1019804
Alignment:
Q |
8 |
gaaccatgtcctggaactggatcccttagatctagatggagcatgtgaaggattttttcagcgatgatctcataatcatatgtgtgtctaaatgtgcacg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1020122 |
gaaccatgtcctggaactggatcccttagatctagatggagcatgtgaaggattttttcagcgatgatctcataatcatatgtgtgtctaaatgtgcacg |
1020023 |
T |
 |
Q |
108 |
tatcaaagtcacttcggcaattttttatgatttaatgtgtcttttggattgacaaaatgagtttgacagaatcgttatggaccattcaattttgacaaga |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1020022 |
tatcaaagtcacttcggcaattttttatgatttaatgtgtcttttggattgacaaaatgagtttgacagaatcgttatggaccattcaattttgacaaga |
1019923 |
T |
 |
Q |
208 |
gcttcaacaaaagcacattgtcagtttgagttcaataatctcaccgccaatctaaacagacattagacatctcatcatattccttctgatactccctcat |
307 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
1019922 |
gcttcaacaaaagcacattgtcagtttgagttcaataatctcaccgccaatctaaacagacattagacatctcatcatattccttccgatactccctcat |
1019823 |
T |
 |
Q |
308 |
aattttgaatttcaaagta |
326 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
1019822 |
aattttgaatttcaaagta |
1019804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University