View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713-Insertion-9 (Length: 255)
Name: NF0713-Insertion-9
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713-Insertion-9 |
 |  |
|
| [»] chr3 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 114 - 255
Target Start/End: Original strand, 47927862 - 47928003
Alignment:
| Q |
114 |
tatgatgaaatgaatgatttgataagaaacaacaagaaagtaaacttgcaagaaacatatttattgttcatcaaacacattatatattatatagttaatc |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47927862 |
tatgatgaattgaatgatttgataagaaacaacaagaaagtaaacttgcaagaaacatatttattgttcatcaaacacattatatattatatagttaatc |
47927961 |
T |
 |
| Q |
214 |
aatatctgatttcaagcacataaaggagggtttcttccagct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47927962 |
aatatctgatttcaagcacataaaggagggtttcttccagct |
47928003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 193
Target Start/End: Complemental strand, 37432026 - 37431956
Alignment:
| Q |
123 |
atgaatgatttgataagaaacaacaagaaagtaaacttgcaagaaacatatttattgttcatcaaacacat |
193 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37432026 |
atgaatgattagataagaaacaacaagaaagtaaacttgcaagaaacatatttattgttcatcaaacacat |
37431956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 47927756 - 47927793
Alignment:
| Q |
8 |
atttaactattaacaatacactctcgcagcttataaga |
45 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
47927756 |
atttaactattgacaatacagtctcgcagcttataaga |
47927793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 37432139 - 37432103
Alignment:
| Q |
9 |
tttaactattaacaatacactctcgcagcttataaga |
45 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
37432139 |
tttaactattaacaatacacactcgcatcttataaga |
37432103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University