View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_high_25 (Length: 236)
Name: NF0713_high_25
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 8897123 - 8897325
Alignment:
| Q |
13 |
aaggttttggttgtgaaaactgtagttagcgtcataacagcaattatgatgatgttctgaattgtgactttcaggattggactgggaggaggaacttgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897123 |
aaggttttggttgtgaaaactgtagttagcgtcataacagcaattatgatcatgttctgaattgtgactttcaggattggactgggaggaggaacttgat |
8897222 |
T |
|
| Q |
113 |
ggaaagggagagctctctttttggcaatttgatttaggagtcaacatgtgatggaaaacattatcagctgagagtccaagttgttcatactgagccatga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8897223 |
ggaaagggagagctctctttttggcaatttgatttaggagtcaacatgtgatggaaaacattatcagctgagagtccaagttgttcatactgagccatga |
8897322 |
T |
|
| Q |
213 |
ctg |
215 |
Q |
| |
|
||| |
|
|
| T |
8897323 |
ctg |
8897325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University