View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_high_26 (Length: 236)

Name: NF0713_high_26
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_high_26
NF0713_high_26
[»] chr8 (1 HSPs)
chr8 (24-221)||(8896915-8897112)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 8897112 - 8896915
Alignment:
24 ctgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttggcaatgacttttgtcatgcttcaaatcatattaatagttgtggcaatgt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8897112 ctgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttggcaatgacttttgtcatgcttcaaatcatattaatagtcgtggcaatgt 8897013  T
124 tggagaggttatttcaaatgcggttactaagaattcaagaacttctagtgatggtaggcgctatagtcatagtaattatgattatgattgtgatgatg 221  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
8897012 tggagaggctatttcaaatgcggttactaagaattcaagaacttctagtgatggtaggcgctataatcatagtaattatgattatgattgtgatgatg 8896915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University