View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_18 (Length: 399)
Name: NF0713_low_18
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 93 - 340
Target Start/End: Original strand, 42934806 - 42935038
Alignment:
| Q |
93 |
ataggcaaggcagtaataaaagaataggcagaggactgcattgattggaaaggtgtagcagcaatttgtttattctttcaaattagcttaagattgcaga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934806 |
ataggcaaggcagtaataaaagaataggcagaggactgcattgattggaaaggtgtagcagc--tttgtttattctttcaaattagcttaagattgcaga |
42934903 |
T |
 |
| Q |
193 |
atttttcttgctggtttttctagttgttaattagacttagattggcactagatgtgtccaaactttagactagtatttttcttttgtaagacatagattt |
292 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934904 |
atttt-------------tctagttgttaattagacttagattggcactagatgtgtccaaactttagactagtatttttcttttgtaagacatagattt |
42934990 |
T |
 |
| Q |
293 |
cagaatttttcttgctctttcctattgcatctacgttattgattggag |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934991 |
cagaatttttcttgctctttcctattgcatctacgttattgattggag |
42935038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 356 - 388
Target Start/End: Original strand, 42935061 - 42935093
Alignment:
| Q |
356 |
cggcttcaacaacgtttatttccgatttttcat |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42935061 |
cggcttcaacaacgtttatttccgatttttcat |
42935093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University