View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_22 (Length: 347)
Name: NF0713_low_22
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3001789 - 3002011
Alignment:
Q |
1 |
tgtctaaattgt-gccgctacggaaatattttactagcatgcgttggttatgaatatgaatataatgtgctttgacatctgctgctgtacaatataatga |
99 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
T |
3001789 |
tgtctaaattgttgccactacggaaatattttactagcatgtgttggttatgaatatgaatataatgtgctttggcatctgctgctgcacaatataatga |
3001888 |
T |
 |
Q |
100 |
ttgatatctaatgatatattgtactaaatgggatagtaatactatttaaaggttgcataaacggtaattgctgcagtttcttgtccaaactttatgac-a |
198 |
Q |
|
|
||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
3001889 |
ttg-tatgtaatgatatattatactaaatgggatagtaatactatttaaaggttgcataaatggtaattgctgcagtttcttgtccaaactttatgactt |
3001987 |
T |
 |
Q |
199 |
ttgacttgtttttacagagttatc |
222 |
Q |
|
|
|||||||||||||||| ||||||| |
|
|
T |
3001988 |
ttgacttgtttttacatagttatc |
3002011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 238 - 307
Target Start/End: Original strand, 16895055 - 16895126
Alignment:
Q |
238 |
taaacccagttgaatcatgcagtatacacatt--gggtctaaaatgttttctcttccccaaaaggaaaagta |
307 |
Q |
|
|
|||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||| |
|
|
T |
16895055 |
taaacccaattgaatcatgcagtatacatattatgggtctaaaatgttttctcttccccaaagggaaaagta |
16895126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 32706991 - 32707096
Alignment:
Q |
1 |
tgtctaaattgtgccgctacggaaatattttactagcatgcgttggttatgaatatgaatataatgtgctttgacatctgctgctgtacaatataatgat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
T |
32706991 |
tgtctaaattgtgccgctacggaaatattttactagcatgcgttggttatgaatatgaatataatgtgcttttacatctgctgctgcacaatataatgat |
32707090 |
T |
 |
Q |
101 |
tgatat |
106 |
Q |
|
|
|||||| |
|
|
T |
32707091 |
tgatat |
32707096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University