View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_29 (Length: 326)
Name: NF0713_low_29
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 24104493 - 24104774
Alignment:
| Q |
1 |
tactaaattttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagatttaacggcacacaa |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24104493 |
tactaagttttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagacttaacggcacacaa |
24104592 |
T |
|
| Q |
101 |
ttattttcttatgacttattgttatgttggtgatgtggaagcggcggttagggttttgaggacgatgggggaggagggtttttgttttgattcgcgaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24104593 |
ttattttcttatgacttattgttatgttggtgatgtggaagcggcggttacggttttgaggacgatggaggaggagggtttttgttttgattcgcgaact |
24104692 |
T |
|
| Q |
201 |
tatgacgcgcttgtgttaggcgcgtgtaggaagaggaatgtggttggagctatggtgttggtgaggaggatggtggatgatg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24104693 |
tatgacgcgcttgtgttaggcgcgtgtaggaagaggaatgtggttggagctatggtgttggtgaggaggatggtggatgatg |
24104774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University