View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_33 (Length: 318)
Name: NF0713_low_33
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 97 - 227
Target Start/End: Complemental strand, 13009138 - 13009008
Alignment:
| Q |
97 |
attctcaaaatcatattcaccttttggatcaatcactgctttcaactctcctctttccaaatatggtctcagcttttccaatatttcacctgacactgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
13009138 |
attctcaaaatcatattcaccttttggatcaatcacagcttttaactctcctctttccaaatatggtctcagcttttccaatatttcaccacaaactgtc |
13009039 |
T |
|
| Q |
197 |
aaacttgaataaactgcttttggatgtgatg |
227 |
Q |
| |
|
|||||||||||||||||| || |||||||| |
|
|
| T |
13009038 |
aaacttgaataaactgctctttcatgtgatg |
13009008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 97 - 227
Target Start/End: Original strand, 13118308 - 13118438
Alignment:
| Q |
97 |
attctcaaaatcatattcaccttttggatcaatcactgctttcaactctcctctttccaaatatggtctcagcttttccaatatttcacctgacactgtc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
13118308 |
attctcaaaatcatattcaccttttggatcaatcacagcttttaactctcctctttccaaatatggtctcagcttttccaatatttcaccacaaactgtc |
13118407 |
T |
|
| Q |
197 |
aaacttgaataaactgcttttggatgtgatg |
227 |
Q |
| |
|
|||||||||||||||||| || |||||||| |
|
|
| T |
13118408 |
aaacttgaataaactgctctttcatgtgatg |
13118438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University