View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_41 (Length: 286)
Name: NF0713_low_41
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 22 - 283
Target Start/End: Original strand, 52376511 - 52376772
Alignment:
Q |
22 |
catcatcatcgtctgttagatccccttgaggtgctccggctggcgacacaattggagcacttccaggtgctttagaactaccggctacattctcgccatt |
121 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
T |
52376511 |
catcatcatcatctgttagatccccttgaggtgctccggttggagacacaattggagcactttcaggtgctttagaactaccggctacattcgcgccatt |
52376610 |
T |
 |
Q |
122 |
gccttttggtgcctctgcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgcagattcaggtgttttgcttggttcgtttgatggtgcattt |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52376611 |
gccttttggtgcctctgcaggcgcgttggtggatgctgctgtgggtgcatttgtgggtgcagattcaggtgttttgcttggttcgtttgatggtgcattt |
52376710 |
T |
 |
Q |
222 |
gttggtgcttgttgtggtgatttattggatgaaccatctgttgttggtgtctgtgctcctcc |
283 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
T |
52376711 |
gttggtgcttgttgtggtgatttattggatgaaccatctgctgttggtgtcggtgctcctcc |
52376772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University