View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_47 (Length: 272)
Name: NF0713_low_47
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 45 - 238
Target Start/End: Original strand, 51918334 - 51918526
Alignment:
| Q |
45 |
atcatcataaaacaaagtcctagtagcaaatacttgtaacatactcttcattatcatgaagnnnnnnnncttctttatcctnnnnnnnntagaaaggggt |
144 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
51918334 |
atcatcataaaacatagtcctagtagcaaatacttgtaacacactctacattatcatgaaaaaaaaaaacttctttatcctaaaaaaa-tagaaaggggt |
51918432 |
T |
 |
| Q |
145 |
tttaattagctcttcgattcttaggggaaaatgacctaataacctaaagttcgactaaaaggtaagtacagtctaactaatactcccttcgtct |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||| ||||||||||||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
51918433 |
tttaattagctcttcgattcttagaggaaaagaacccaataatctaaagttcgactaaaaggtaagtaaagtctaacaaatactccctccgtct |
51918526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University