View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_49 (Length: 265)
Name: NF0713_low_49
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 38723405 - 38723647
Alignment:
Q |
13 |
aatatatctacactaaa-tgcaataaaaataaatacagactaacatgttggtgtccgttcatccaacta-----tcttgtacgtatataactgagttgat |
106 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||| ||||| ||||| |
|
|
T |
38723405 |
aatatatctacactaaaatgcaataaaaataaatacagactaatatgtcggtgtccgttcatccaactaatttatcttgtacgtata--actgaattgat |
38723502 |
T |
 |
Q |
107 |
agtgtaaggaagttgatgttgatatataccgatttaatttcgaatatgagattttatacttctctatacttaatgtgcttggttatatgac-------nn |
199 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||| |
|
|
T |
38723503 |
agtgtaaggatgttgatgttgatatataccgatttaatttcgaatatgaaattttaaacttctctacacttaatgtgcttggttatatgaccaaaaaaaa |
38723602 |
T |
 |
Q |
200 |
nnnnnnnggatttatttagatataagctattcaagagtcaagact |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
38723603 |
aaaaaaaggatttatttagatataagctattcaagagtcaagact |
38723647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University