View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_51 (Length: 262)
Name: NF0713_low_51
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_51 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 29483557 - 29483789
Alignment:
| Q |
30 |
aaaattgcatacattcattttcaaagaagcttattatcaaatcatgaatgaatattatatagtgcagaaaaggttatgctttattttggtgatgcctatg |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29483557 |
aaaattgcgtacattcattttcaaagaagcttattatcaaatcatgaatgaatattatatagtgcagaaaaggttatgctttattttggtgattcctatg |
29483656 |
T |
 |
| Q |
130 |
tagtagcaaatcaaataaatgtaagatagagaatcaaaaaatcataggaagacnnnnnnnnnnnnnnnnntactttaaaacaaagcaattatgtaaaagc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29483657 |
tagtagcaaatcaaataaatgtaagatagagaatcaaaaaatcataggaagacaaaaaaaaatgaaaaaatactttaaaacaaagcaattatgtaaaagc |
29483756 |
T |
 |
| Q |
230 |
taataattgtttcttatagcaatgaacatatcc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29483757 |
taataattgtttcttatagcaatgaacatatcc |
29483789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University