View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_52 (Length: 261)
Name: NF0713_low_52
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 67 - 237
Target Start/End: Original strand, 27693449 - 27693622
Alignment:
| Q |
67 |
ccaatgcatatgatagaag-----tgtcttttaactaaatgtgtatctagtgcgnnnnnnnnnnnnnacttacgcaagagaatgaagagaaatagagcgc |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
27693449 |
ccaatgcatatgatagaagctaagtgtcttttaactaaatgtgtatctagtgcgttttttttttt--acttacgcaagagaatgaagaaaaatagagcgc |
27693546 |
T |
|
| Q |
162 |
gcactgctgtatcgtatatcatgctgcggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
237 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693547 |
ccattgctgtatcgtatatcatgctggggtatgacaattgttcctcttcccggtcacggtctctgtcttgctgatg |
27693622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University