View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_59 (Length: 251)
Name: NF0713_low_59
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29009023 - 29008802
Alignment:
| Q |
1 |
tgttacggtgttatattcattcaattagatgaagaatttgaatcgaagctatagttaactctgtgnnnnnnnnnnnnnnnnnnnnnnnntaggaaaatga |
100 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29009023 |
tgttacggtgttgtattcattcgattagatgaagaatttgaatcgaagctatagttaactctgtgtttttgattttttggtttgatttgtaggaaaatga |
29008924 |
T |
|
| Q |
101 |
ggccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcaattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008923 |
ggccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcgattctcttccgttgcgtttgtggtggtaaccacaccgttggtggtgcttccgc |
29008824 |
T |
|
| Q |
201 |
ctgggatcttgaatccaatatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29008823 |
ctgggatcttgaatccaatatg |
29008802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University