View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_60 (Length: 251)
Name: NF0713_low_60
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37228883 - 37229105
Alignment:
| Q |
1 |
tttgaagttaacttagatcctttcatgtgtatctcgcatgatgcatttttatttttgcaacgtattttgaaatctgatgcccaggagtttaagtctggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37228883 |
tttgaagttaacttagatcctttcatgtgtatctcacatgatgcatttttatttttgcaacgtattttgaaatctgatgcccaggagtttaagtctggaa |
37228982 |
T |
|
| Q |
101 |
catttttctaacagtaatctgatgtacaactggaagtgatgttttcacacttgctctgtttgctttctttttgtctggtgc--tttgtctttctaaggag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37228983 |
catttttctaacagtaatctgatgtacaactggaagtgatgttttcacacttgctctgtttgctttctttttgtctggtgctttttgtctttctaaggag |
37229082 |
T |
|
| Q |
199 |
aaacttaggggttgtttgtcaag |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37229083 |
aaacttaggggttgtttgtcaag |
37229105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University