View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_low_62 (Length: 251)

Name: NF0713_low_62
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_low_62
NF0713_low_62
[»] chr5 (1 HSPs)
chr5 (30-221)||(4614986-4615177)


Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 4615177 - 4614986
Alignment:
30 aaaacaacgcgaaactgcggcgcgtttgactcaaccgccggtaggatctcccaacggcaaggctcaagatcttcagaaactggacaataaccggcaagag 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4615177 aaaacaacgcgaaactgcggcgcgtttgactcaaccgccggtaggatctcccaacggcaaggctcaagatcttcagaaactggacaataaccggcaagag 4615078  T
130 taaccttatcgttgctcgcagcaaccgaaccaaactcgaaaactgaaacactcgcgttcttaggtcgtttaacctccactgcaccgttcatc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4615077 taaccttatcgttgctcgcagcaaccgaaccaaactcgaaaactgaaacactcgcgttcttaggtcgtttaacctccactgcaccgttcatc 4614986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University