View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_62 (Length: 251)
Name: NF0713_low_62
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 4615177 - 4614986
Alignment:
| Q |
30 |
aaaacaacgcgaaactgcggcgcgtttgactcaaccgccggtaggatctcccaacggcaaggctcaagatcttcagaaactggacaataaccggcaagag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615177 |
aaaacaacgcgaaactgcggcgcgtttgactcaaccgccggtaggatctcccaacggcaaggctcaagatcttcagaaactggacaataaccggcaagag |
4615078 |
T |
|
| Q |
130 |
taaccttatcgttgctcgcagcaaccgaaccaaactcgaaaactgaaacactcgcgttcttaggtcgtttaacctccactgcaccgttcatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615077 |
taaccttatcgttgctcgcagcaaccgaaccaaactcgaaaactgaaacactcgcgttcttaggtcgtttaacctccactgcaccgttcatc |
4614986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University