View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_63 (Length: 251)
Name: NF0713_low_63
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_63 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 159 - 251
Target Start/End: Complemental strand, 6133474 - 6133382
Alignment:
| Q |
159 |
tgaattaaccgtagaaaccttcaaaagatatgaaggtgatgatgaacacaatgagttagcacaattcatctttgtttcaatagttccctcatt |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6133474 |
tgaattaacagtagaaaccttcaaaagatatgaaggcgatgatgaacacaatgagttagcacaattcatctttgtttcaatagttccctcatt |
6133382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 26379778 - 26379858
Alignment:
| Q |
171 |
agaaaccttcaaaagatatgaaggtgatgatgaacacaatgagttagcacaattcatctttgtttcaatagttccctcatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26379778 |
agaaaccttcaaaagatatgaaggtgatgatgaacacaatgagttagcacaattcatctttgtttcaatagttccctcatt |
26379858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 251
Target Start/End: Complemental strand, 5044657 - 5044620
Alignment:
| Q |
214 |
ttagcacaattcatctttgtttcaatagttccctcatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5044657 |
ttagcacaattcatctttgtttcaatagttccctcatt |
5044620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University