View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_65 (Length: 249)
Name: NF0713_low_65
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_65 |
 |  |
|
| [»] chr6 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 8477005 - 8477250
Alignment:
| Q |
8 |
agattattctaccatgataggacatagcataatgcatttgactctccttttggtcaattcactccaaactggtaaaaattattgtctat----gatttgt |
103 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8477005 |
agattattctatcatgataggacatggcataatgcatttgactctccttttggtcaattcactcccaactggtaaaaattattgtctattaaagatttgt |
8477104 |
T |
 |
| Q |
104 |
tcctctcaattgtatgaccacaaccagccttgctttcatgatttgtcattgcaacgttgaaaccatttgcaagactgcaaaagacccttctttttgttca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8477105 |
tcctctcaattgtatgaccacaaccagccttgctttcatgatttgtcattgcaacgttgaaaccatttgcaagactgcaaaagacccttctttttgttca |
8477204 |
T |
 |
| Q |
204 |
acttttctcaaatcaagatctgctggtgtaggtcgagatctcgtta |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8477205 |
acttttctcaaatcaagacctgctggtgtaggtcgagacctcgtta |
8477250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 249
Target Start/End: Original strand, 8638197 - 8638262
Alignment:
| Q |
184 |
aagacccttctttttgttcaacttttctcaaatcaagatctgctggtgtaggtcgagatctcgtta |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| || ||||| || || ||||||| |||| |
|
|
| T |
8638197 |
aagacccttcattttgttcaacttttctcaaatcaagacctcctggtataagtggagatcttgtta |
8638262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 195 - 249
Target Start/End: Complemental strand, 8634075 - 8634021
Alignment:
| Q |
195 |
ttttgttcaacttttctcaaatcaagatctgctggtgtaggtcgagatctcgtta |
249 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| || |||||||||||| |
|
|
| T |
8634075 |
ttttgttcaacttttctcaaatcaaggcctcatggtgtaagtggagatctcgtta |
8634021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 8503671 - 8503707
Alignment:
| Q |
183 |
aaagacccttctttttgttcaacttttctcaaatcaa |
219 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
8503671 |
aaagacccttctttttgtttaactcttctcaaatcaa |
8503707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University