View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_66 (Length: 245)
Name: NF0713_low_66
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 29958654 - 29958817
Alignment:
| Q |
1 |
tatggggattcttggtgtctaaactatcttcttcctgcccctggagccgcctctttttacctgcggtaacatgtctattactttcattctgctgctgtga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958654 |
tatggggattcttggtggctaaactatcttcttcctgcccctggagccgcctctttttacctgcggtaacatgtctattactttcattctgctgctgtga |
29958753 |
T |
|
| Q |
101 |
aaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatcttttgctga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29958754 |
aaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatctgttgctga |
29958817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University