View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_69 (Length: 242)
Name: NF0713_low_69
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 38 - 218
Target Start/End: Original strand, 51993256 - 51993426
Alignment:
Q |
38 |
ggtttgcactgtcctattttatacatcacgttgaattccaattgccgtctcatttccnnnnnnnnnnnnngggcctgcgtgtgttcttttaattacttgg |
137 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
51993256 |
ggtttgcactgccctattttatacatcacgttgaattccaattgccgtctcatttccttt----------gggcctgcgtgtgttcttttaattacttgg |
51993345 |
T |
 |
Q |
138 |
gcctcaaagtctggattcatttcttttctcacactactcacttctccattttggctcggcttatattatataatctgaacc |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51993346 |
gcctcaaagtctggattcatttcttttctcacgctactcacttctccattttggctcggcttatattatataatctgaacc |
51993426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University