View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_low_72 (Length: 241)

Name: NF0713_low_72
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_low_72
NF0713_low_72
[»] chr6 (21 HSPs)
chr6 (1-112)||(26216034-26216145)
chr6 (153-224)||(26215918-26215989)
chr6 (10-104)||(32935362-32935457)
chr6 (32-105)||(26534741-26534815)
chr6 (56-112)||(9224051-9224107)
chr6 (44-101)||(34105410-34105468)
chr6 (61-104)||(3117508-3117551)
chr6 (27-104)||(12794094-12794173)
chr6 (34-104)||(16510324-16510395)
chr6 (10-104)||(20701826-20701921)
chr6 (152-218)||(12794214-12794279)
chr6 (31-87)||(3880623-3880680)
chr6 (57-101)||(34090374-34090418)
chr6 (32-101)||(21266098-21266168)
chr6 (57-111)||(33968629-33968683)
chr6 (57-92)||(7546464-7546499)
chr6 (38-92)||(20499910-20499965)
chr6 (62-104)||(13423482-13423524)
chr6 (152-190)||(26534648-26534686)
chr6 (57-93)||(12129228-12129264)
chr6 (57-89)||(34092806-34092838)
[»] chr8 (29 HSPs)
chr8 (10-111)||(30236144-30236246)
chr8 (17-104)||(32945726-32945814)
chr8 (34-104)||(15821402-15821473)
chr8 (56-111)||(15906696-15906751)
chr8 (57-104)||(24995418-24995465)
chr8 (57-104)||(31207385-31207432)
chr8 (10-104)||(9519462-9519557)
chr8 (34-104)||(36630824-36630895)
chr8 (42-103)||(10552263-10552325)
chr8 (27-103)||(35062437-35062514)
chr8 (56-104)||(17657025-17657073)
chr8 (152-224)||(41791164-41791235)
chr8 (57-104)||(32066318-32066365)
chr8 (57-104)||(34389028-34389075)
chr8 (57-104)||(37986881-37986928)
chr8 (57-104)||(41893423-41893470)
chr8 (66-104)||(16457484-16457522)
chr8 (61-104)||(10248576-10248619)
chr8 (56-95)||(40531242-40531281)
chr8 (57-95)||(33967337-33967375)
chr8 (15-111)||(17720722-17720818)
chr8 (57-101)||(12898300-12898344)
chr8 (68-104)||(20138448-20138484)
chr8 (164-226)||(32945602-32945663)
chr8 (56-101)||(23264716-23264761)
chr8 (153-194)||(30236056-30236097)
chr8 (61-94)||(36796621-36796654)
chr8 (152-224)||(35062567-35062638)
chr8 (63-111)||(41791280-41791328)
[»] chr7 (40 HSPs)
chr7 (11-104)||(6584873-6584967)
chr7 (10-100)||(38485519-38485610)
chr7 (57-111)||(13311850-13311904)
chr7 (10-103)||(46133302-46133396)
chr7 (34-104)||(6716759-6716830)
chr7 (35-104)||(34389950-34390020)
chr7 (59-104)||(10244195-10244240)
chr7 (32-111)||(12480871-12480951)
chr7 (34-104)||(3478339-3478410)
chr7 (56-103)||(9349759-9349806)
chr7 (57-104)||(38306272-38306319)
chr7 (34-102)||(8745140-8745209)
chr7 (57-110)||(9428122-9428175)
chr7 (34-98)||(42533281-42533346)
chr7 (56-104)||(33435119-33435167)
chr7 (34-104)||(24324821-24324892)
chr7 (57-111)||(11379143-11379197)
chr7 (152-222)||(38485665-38485734)
chr7 (57-95)||(46262151-46262189)
chr7 (56-104)||(1320804-1320852)
chr7 (56-104)||(3419679-3419727)
chr7 (25-104)||(16954631-16954711)
chr7 (56-104)||(41089771-41089819)
chr7 (9-104)||(47457045-47457141)
chr7 (61-104)||(3867131-3867174)
chr7 (34-104)||(16828959-16829030)
chr7 (61-104)||(37795004-37795047)
chr7 (57-104)||(47325908-47325955)
chr7 (58-92)||(17802851-17802885)
chr7 (57-95)||(27993568-27993606)
chr7 (57-95)||(35206725-35206763)
chr7 (34-83)||(44755613-44755663)
chr7 (34-98)||(25160802-25160867)
chr7 (68-104)||(44353587-44353623)
chr7 (57-104)||(5860311-5860358)
chr7 (56-98)||(23983205-23983247)
chr7 (57-91)||(25153231-25153265)
chr7 (56-98)||(35745856-35745898)
chr7 (56-101)||(48058680-48058725)
chr7 (38-105)||(26386197-26386265)
[»] chr1 (32 HSPs)
chr1 (9-111)||(17033548-17033651)
chr1 (10-99)||(46814495-46814585)
chr1 (10-100)||(4651743-4651834)
chr1 (34-98)||(7857640-7857705)
chr1 (34-104)||(9313312-9313383)
chr1 (34-104)||(24658916-24658987)
chr1 (10-104)||(27031863-27031958)
chr1 (57-104)||(31585783-31585830)
chr1 (57-104)||(41920463-41920510)
chr1 (56-109)||(38544756-38544809)
chr1 (9-104)||(19598598-19598694)
chr1 (34-104)||(24684501-24684572)
chr1 (57-104)||(46692842-46692889)
chr1 (57-98)||(5459172-5459213)
chr1 (45-101)||(15840938-15840995)
chr1 (34-101)||(34774858-34774925)
chr1 (152-223)||(4651889-4651959)
chr1 (65-104)||(5389444-5389483)
chr1 (34-104)||(6583239-6583310)
chr1 (65-104)||(27102210-27102249)
chr1 (57-104)||(30685927-30685974)
chr1 (57-101)||(30655571-30655615)
chr1 (61-104)||(24449953-24449996)
chr1 (57-111)||(46603403-46603457)
chr1 (152-224)||(2988019-2988090)
chr1 (56-104)||(27905422-27905470)
chr1 (34-104)||(32864584-32864655)
chr1 (10-104)||(50589230-50589325)
chr1 (57-95)||(38564912-38564950)
chr1 (58-100)||(42374175-42374217)
chr1 (59-100)||(42374049-42374090)
chr1 (57-101)||(33034672-33034716)
[»] chr5 (24 HSPs)
chr5 (10-103)||(31721640-31721734)
chr5 (34-104)||(7392054-7392125)
chr5 (56-104)||(34378108-34378156)
chr5 (34-111)||(39184203-39184281)
chr5 (10-98)||(13954263-13954351)
chr5 (10-110)||(33258899-33259000)
chr5 (56-104)||(7195262-7195310)
chr5 (56-106)||(23426354-23426404)
chr5 (34-111)||(24072282-24072360)
chr5 (44-99)||(12046252-12046308)
chr5 (56-104)||(22675347-22675395)
chr5 (56-104)||(25992017-25992065)
chr5 (34-104)||(8297455-8297526)
chr5 (57-112)||(8730928-8730983)
chr5 (61-104)||(21402860-21402903)
chr5 (57-98)||(698372-698413)
chr5 (36-104)||(14302453-14302522)
chr5 (15-111)||(17854083-17854180)
chr5 (63-104)||(18593260-18593301)
chr5 (56-96)||(26045995-26046035)
chr5 (56-104)||(27713079-27713127)
chr5 (56-104)||(29087491-29087539)
chr5 (34-111)||(39024466-39024544)
chr5 (57-89)||(25341709-25341741)
[»] scaffold0200 (1 HSPs)
scaffold0200 (34-104)||(19370-19441)
[»] chr4 (38 HSPs)
chr4 (10-104)||(53823444-53823539)
chr4 (10-104)||(25753135-25753230)
chr4 (10-104)||(35800453-35800547)
chr4 (34-111)||(46698801-46698879)
chr4 (34-109)||(31050680-31050756)
chr4 (9-104)||(38929789-38929885)
chr4 (10-104)||(4305688-4305783)
chr4 (34-101)||(19311369-19311435)
chr4 (57-111)||(21387220-21387274)
chr4 (35-104)||(22811183-22811253)
chr4 (152-226)||(43373992-43374065)
chr4 (34-110)||(16501718-16501795)
chr4 (57-101)||(39041300-39041344)
chr4 (37-104)||(49747517-49747585)
chr4 (34-104)||(2061761-2061832)
chr4 (57-104)||(38637255-38637302)
chr4 (15-104)||(19815247-19815337)
chr4 (60-98)||(39421042-39421080)
chr4 (57-95)||(40813813-40813851)
chr4 (56-104)||(8255037-8255085)
chr4 (56-104)||(8268455-8268503)
chr4 (56-92)||(53756766-53756802)
chr4 (57-104)||(6599968-6600015)
chr4 (17-111)||(12296145-12296240)
chr4 (57-100)||(36962642-36962685)
chr4 (34-94)||(2825770-2825831)
chr4 (63-104)||(30167587-30167628)
chr4 (59-104)||(30964454-30964499)
chr4 (57-90)||(37707392-37707425)
chr4 (57-101)||(2792300-2792344)
chr4 (61-101)||(26474851-26474891)
chr4 (31-101)||(48098317-48098388)
chr4 (57-95)||(10388572-10388610)
chr4 (59-96)||(12296061-12296098)
chr4 (58-111)||(24740119-24740172)
chr4 (63-95)||(17416541-17416573)
chr4 (56-104)||(28966877-28966925)
chr4 (156-224)||(35800603-35800670)
[»] chr3 (32 HSPs)
chr3 (34-104)||(19176489-19176560)
chr3 (57-104)||(17550968-17551015)
chr3 (10-111)||(30935406-30935508)
chr3 (56-109)||(14755283-14755336)
chr3 (34-102)||(14879422-14879491)
chr3 (34-98)||(34475783-34475848)
chr3 (56-104)||(43012385-43012433)
chr3 (34-104)||(9584076-9584147)
chr3 (57-111)||(5556581-5556635)
chr3 (9-101)||(47945667-47945761)
chr3 (55-104)||(33143972-33144021)
chr3 (156-224)||(30935289-30935356)
chr3 (34-104)||(14193927-14193998)
chr3 (56-95)||(20710740-20710779)
chr3 (61-104)||(37123397-37123440)
chr3 (61-104)||(39021299-39021342)
chr3 (34-104)||(45398783-45398854)
chr3 (57-103)||(30127273-30127319)
chr3 (39-111)||(1652902-1652975)
chr3 (56-97)||(40023602-40023643)
chr3 (64-104)||(20611801-20611841)
chr3 (57-101)||(24099353-24099397)
chr3 (34-96)||(23328381-23328444)
chr3 (34-96)||(25647671-25647734)
chr3 (64-101)||(823461-823498)
chr3 (60-104)||(2392529-2392573)
chr3 (60-104)||(2394276-2394320)
chr3 (57-100)||(31424247-31424290)
chr3 (63-101)||(45163872-45163910)
chr3 (57-94)||(31482895-31482932)
chr3 (57-101)||(2782095-2782139)
chr3 (57-101)||(19295891-19295935)
[»] chr2 (35 HSPs)
chr2 (56-111)||(22885149-22885204)
chr2 (34-104)||(1269470-1269541)
chr2 (34-104)||(7874278-7874349)
chr2 (10-103)||(31902438-31902532)
chr2 (44-104)||(14405195-14405256)
chr2 (56-112)||(33788647-33788703)
chr2 (34-104)||(14106547-14106618)
chr2 (57-104)||(39338888-39338935)
chr2 (57-98)||(10524108-10524149)
chr2 (56-104)||(15126433-15126481)
chr2 (56-104)||(16959992-16960040)
chr2 (57-104)||(4471934-4471981)
chr2 (34-104)||(13337261-13337332)
chr2 (17-103)||(18681035-18681122)
chr2 (57-95)||(4162052-4162090)
chr2 (56-104)||(387183-387231)
chr2 (152-224)||(12793631-12793702)
chr2 (57-104)||(23650396-23650443)
chr2 (57-112)||(25504924-25504979)
chr2 (56-111)||(27739985-27740040)
chr2 (58-104)||(2062901-2062947)
chr2 (56-101)||(10173604-10173649)
chr2 (152-224)||(915353-915424)
chr2 (56-111)||(5254266-5254321)
chr2 (56-95)||(9560820-9560859)
chr2 (57-92)||(23665439-23665474)
chr2 (34-104)||(37770664-37770735)
chr2 (10-111)||(29487094-29487195)
chr2 (57-98)||(36276200-36276241)
chr2 (34-90)||(41086825-41086882)
chr2 (68-104)||(7695985-7696021)
chr2 (34-104)||(17105398-17105470)
chr2 (152-224)||(18681175-18681246)
chr2 (57-101)||(34143079-34143123)
chr2 (64-104)||(34230219-34230259)
[»] scaffold0119 (1 HSPs)
scaffold0119 (34-104)||(42161-42232)
[»] scaffold0050 (1 HSPs)
scaffold0050 (34-104)||(36694-36765)
[»] scaffold1613 (1 HSPs)
scaffold1613 (56-109)||(1035-1088)
[»] scaffold0620 (2 HSPs)
scaffold0620 (57-101)||(3841-3885)
scaffold0620 (57-89)||(8140-8172)
[»] scaffold0068 (1 HSPs)
scaffold0068 (57-98)||(35800-35841)
[»] scaffold0063 (1 HSPs)
scaffold0063 (34-98)||(58114-58179)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 21)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 26216145 - 26216034
Alignment:
1 ccaccgtaattctatggtggaccggaggtaagaggtgcccttctgatttgattctaagtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26216145 ccaccgtaattctatgatggaccggaggtaagaggtgcccttctgatttgattctaagtctggtgggccgatcacttttgattcgagatcgggagtcagt 26216046  T
101 tcttcggttcag 112  Q
    ||||||||||||    
26216045 tcttcggttcag 26216034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 153 - 224
Target Start/End: Complemental strand, 26215989 - 26215918
Alignment:
153 ttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26215989 ttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 26215918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 32935457 - 32935362
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||| ||| ||| || ||| ||||||||||||| | || |||||||||||||||||| ||||||||||||||||||||||||||||||    
32935457 ttctatgatggatcgggggtgaggggttcccttctgatttggtcctgaagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctt 32935362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 32 - 105
Target Start/End: Complemental strand, 26534815 - 26534741
Alignment:
32 gaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttc 105  Q
    |||||| |||||||||||| | || |||||||||||||||||||||||||||||||||| |||||||||||||||    
26534815 gaggtggccttctgatttggtcctgaagtctggtgggccgatcacttttgattcgagattgggagtcagttcttc 26534741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 56 - 112
Target Start/End: Original strand, 9224051 - 9224107
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttcag 112  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||    
9224051 aagtctggtgggctgatcgcttttgattcgagatcgggagtcagttctttggttcag 9224107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 101
Target Start/End: Original strand, 34105410 - 34105468
Alignment:
44 tgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||    
34105410 tgatttgtttctagagtttggtgggccgatcacttttgattcgagatcgggagtcagtt 34105468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 3117508 - 3117551
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||||| |||||||||||||||||||    
3117508 tggtgggccgatcacttttgattcaagatcgggagtcagttctt 3117551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 27 - 104
Target Start/End: Original strand, 12794094 - 12794173
Alignment:
27 ggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatca-cttttgattcgagatcgggagtcagttctt 104  Q
    |||||| |||| ||||||| |||| |||||| |||| |||||||||||| |||||||||||||||| |||||||||||||    
12794094 ggtaaggggtgtccttctgttttggttctaaagtctagtgggccgatcaacttttgattcgagatcaggagtcagttctt 12794173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 16510395 - 16510324
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| || ||||| |||||| |||| ||||||||||||||||||||||||||| | ||||||||||||    
16510395 ggtgccctgctaatttggttctaaagtctagtgggccgatcacttttgattcgagattgagagtcagttctt 16510324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 20701921 - 20701826
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||| ||| || ||||||||||||||||| |  |  || |||||| |||||||||||||||||||||||||||||| |||||||    
20701921 ttctctggtgtaccgggggtgaggggtgcccttctgatttggtcatttagactggtgtgccgatcacttttgattcgagatcgggagttagttctt 20701826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 218
Target Start/End: Original strand, 12794214 - 12794279
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttgg 218  Q
    ||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||| ||| |||||||    
12794214 gttgcgcggtggtggaagcagattgatctttagaaaagga-tttcttcagatgtgactcggtgttgg 12794279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 3880680 - 3880623
Alignment:
31 agaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgag 87  Q
    |||||||||||||||||||| | |||| || |||||||||||||||||||||||||||    
3880680 agaggtgcccttctgatttggtcctaaagtttggtgggccgatcacttttgattcgag 3880623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 101
Target Start/End: Original strand, 34090374 - 34090418
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||    
34090374 agtctggtgggtcgatcaattttgattcgagatcgggagtcagtt 34090418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 32 - 101
Target Start/End: Original strand, 21266098 - 21266168
Alignment:
32 gaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||| |||| ||||||| | |||| | |||||||||||||| |||||||||||||||||||||| ||||    
21266098 gaggtggccttatgatttggtcctaaagactggtgggccgatcgcttttgattcgagatcgggagttagtt 21266168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 33968683 - 33968629
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||| |||||  |||| |||||||||||||||||||||||||||||| ||||||    
33968683 agtctagtgggtagatcgcttttgattcgagatcgggagtcagttctttggttca 33968629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 92
Target Start/End: Complemental strand, 7546499 - 7546464
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgg 92  Q
    |||||||||| |||||||||||||||||||||||||    
7546499 agtctggtggaccgatcacttttgattcgagatcgg 7546464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 92
Target Start/End: Original strand, 20499910 - 20499965
Alignment:
38 cccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgg 92  Q
    ||||||||||||||||||  ||| |||||| |||||| ||||||||||||||||||    
20499910 cccttctgatttgattctggagtatggtggaccgatcgcttttgattcgagatcgg 20499965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 104
Target Start/End: Original strand, 13423482 - 13423524
Alignment:
62 ggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| |||||||||||||||||||||||| ||||| ||||||    
13423482 ggtggaccgatcacttttgattcgagatcgagagtcggttctt 13423524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 190
Target Start/End: Complemental strand, 26534686 - 26534648
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaagg 190  Q
    |||| |||||||||||||||||||||||||| |||||||    
26534686 gttgtgcggtggtggaagctgattgatctttagaaaagg 26534648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 12129228 - 12129264
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcggg 93  Q
    |||||| ||| ||||||||||||||||||||||||||    
12129228 agtctgatggtccgatcacttttgattcgagatcggg 12129264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 34092806 - 34092838
Alignment:
57 agtctggtgggccgatcacttttgattcgagat 89  Q
    ||||||||| |||||||||||||||||||||||    
34092806 agtctggtgagccgatcacttttgattcgagat 34092838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 29)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 111
Target Start/End: Complemental strand, 30236246 - 30236144
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggt 108  Q
    |||| ||||||||||| |||||| ||||||||||||||||| || | |||||||||||| ||||| |||||||||||||||||||||||||||||| |||    
30236246 ttctctggtggaccgggggtaaggggtgcccttctgatttggttttgaagtctggtgggacgatcgcttttgattcgagatcgggagtcagttctttggt 30236147  T
109 tca 111  Q
    |||    
30236146 tca 30236144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 104
Target Start/End: Complemental strand, 32945814 - 32945726
Alignment:
17 gtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||| |||||||||||||||| |||| | |||||| ||||||||||||||||||||||||||||| |||||    
32945814 gtggaccggaggtaagaggtgctcttctgatttgattctgaagtatagtgggctgatcacttttgattcgagatcgggagtcaattctt 32945726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 15821473 - 15821402
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||| ||||    
15821473 ggtgccctgctgatttggttctaaagtctggtgggctgatcacttttgattcgagatcgggagtcagctctt 15821402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 15906696 - 15906751
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||    
15906696 aagtctggtgggccgatcacatttgattcgagatcgggagtcagttctttggttca 15906751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 24995465 - 24995418
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
24995465 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 24995418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 31207432 - 31207385
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
31207432 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 31207385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 104
Target Start/End: Original strand, 9519462 - 9519557
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||| ||| || |||||||| || ||||| | ||| ||||| |||||||||||| |||||||||||||||||||||||||||||    
9519462 ttctctggtgtaccgggggtgaggggtgccctgctaatttggtactatagtctagtgggccgatcagttttgattcgagatcgggagtcagttctt 9519557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 36630824 - 36630895
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| || ||||| |||||| |||||||||||||||||||||| ||||||||||||| ||||||||||    
36630824 ggtgccctgctaatttggttctaaagtctggtgggccgatcacttttaattcgagatcgggtgtcagttctt 36630895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 10552263 - 10552325
Alignment:
42 tctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    ||||||||| |||| |||||||||||||||||| |||||||||| ||||||||||||||||||    
10552263 tctgatttggttctgaagtctggtgggccgatcgcttttgattctagatcgggagtcagttct 10552325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 27 - 103
Target Start/End: Original strand, 35062437 - 35062514
Alignment:
27 ggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    |||||| ||||||  ||||||||| |||| ||||||||||||||||||  |||||||||||||||| |||||||||||    
35062437 ggtaaggggtgcctctctgatttggttctgaagtctggtgggccgatcgattttgattcgagatcgagagtcagttct 35062514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 17657073 - 17657025
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||||| ||||||||||||||||||||||||||||||||||||    
17657073 aagtatggtgggtcgatcacttttgattcgagatcgggagtcagttctt 17657025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 41791235 - 41791164
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    ||||||||||||||||||| ||||||| ||||||||||||| ||||||| ||||| |||| | ||||||||||    
41791235 gttgcgcggtggtggaagcggattgatatttggaaaaggag-ttcttcagatgtgactcacttttggtgatga 41791164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 32066365 - 32066318
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||||||||||| |||||||||||| ||||    
32066365 agtctggtgggccgatcacttttgattcgaaatcgggagtcagctctt 32066318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 34389075 - 34389028
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||  ||||||||||||    
34389075 agtctggtgggccgatcacttttgattcgagatcaagagtcagttctt 34389028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 37986928 - 37986881
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||| |||| |||||||||||||||||||||||||||||    
37986928 agtctggtgggccaatcatttttgattcgagatcgggagtcagttctt 37986881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 41893470 - 41893423
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||| | ||||||||||||||||||||||||||||||||    
41893470 agtctggtgggccaaccacttttgattcgagatcgggagtcagttctt 41893423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 66 - 104
Target Start/End: Complemental strand, 16457522 - 16457484
Alignment:
66 ggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||||||||||||||||||||    
16457522 ggccgatcacttttgattcgagatcgggagtcagttctt 16457484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 104
Target Start/End: Complemental strand, 10248619 - 10248576
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||| ||||||||||||||||| |||||||||||||||||||    
10248619 tggtggaccgatcacttttgattcaagatcgggagtcagttctt 10248576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 95
Target Start/End: Original strand, 40531242 - 40531281
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    ||||||| ||||||||||||||||||||||||||||||||    
40531242 aagtctgatgggccgatcacttttgattcgagatcgggag 40531281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 33967337 - 33967375
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||||||||||| ||||    
33967337 agtctggtgggccgatcacttttgattcgagatcaggag 33967375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 17720818 - 17720722
Alignment:
15 tggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||| | |||||| ||||||  |||| |||| | |||| || |||||||| |||| ||||||||||| |||||||||||||||||| ||||||    
17720818 tggtggaccaggggtaaggggtgcctgtctggtttggtcctaaagtatggtgggctgatcgcttttgattcg-gatcgggagtcagttctttggttca 17720722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 12898344 - 12898300
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||  ||||||||||||||||||||||| ||||||||||    
12898344 agtctggtgacccgatcacttttgattcgagatccggagtcagtt 12898300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 68 - 104
Target Start/End: Original strand, 20138448 - 20138484
Alignment:
68 ccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||| ||||||||||||||||||||    
20138448 ccgatcacttttgatttgagatcgggagtcagttctt 20138484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 226
Target Start/End: Complemental strand, 32945663 - 32945602
Alignment:
164 tggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatgatg 226  Q
    |||||||||| |||||||| |||||| |||| ||||| ||||| ||| |||||||||||||||    
32945663 tggaagctgaatgatctttagaaaagaagtt-cttcagatgtgactcggtgttggtgatgatg 32945602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 101
Target Start/End: Original strand, 23264716 - 23264761
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||| ||| || |||| ||||||||||||||||||||||||||    
23264716 aagtctgatggacctatcaattttgattcgagatcgggagtcagtt 23264761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 194
Target Start/End: Complemental strand, 30236097 - 30236056
Alignment:
153 ttgcgcggtggtggaagctgattgatctttggaaaaggagtt 194  Q
    |||||| ||||||||||||||||||||||| |||||| ||||    
30236097 ttgcgcagtggtggaagctgattgatctttagaaaagaagtt 30236056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 94
Target Start/End: Original strand, 36796621 - 36796654
Alignment:
61 tggtgggccgatcacttttgattcgagatcggga 94  Q
    |||| |||||||||||||||||||||||||||||    
36796621 tggttggccgatcacttttgattcgagatcggga 36796654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 224
Target Start/End: Original strand, 35062567 - 35062638
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    |||||||||||||||||| ||| |||||||| || |||||| ||||||  | ||||| || ||||||||||||    
35062567 gttgcgcggtggtggaaggtgaatgatctttagagaaggag-ttcttcggaggtggcacaatgttggtgatga 35062638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 111
Target Start/End: Complemental strand, 41791328 - 41791280
Alignment:
63 gtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||| ||||| ||||||||||||||||| |||||| ||||| ||||||    
41791328 gtgggtcgatcgcttttgattcgagatcgagagtcacttctttggttca 41791280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 104
Target Start/End: Original strand, 6584873 - 6584967
Alignment:
11 tctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||| ||||||||  || |||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
6584873 tctatggtgtaccggaggcgaggggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctctt 6584967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 10 - 100
Target Start/End: Original strand, 38485519 - 38485610
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||| |||||||| || |||||| ||||||||||||| ||  |||| |||||||||||||||||||||||||||||||||||||||||||||    
38485519 ttctctggtggactgggggtaaggggtgcccttctgaatttgttctgaagtctggtgggccgatcacttttgattcgagatcgggagtcagt 38485610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 13311850 - 13311904
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
13311850 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctttggttca 13311904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 46133396 - 46133302
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    |||| ||||||||||||||| ||  |||||||||||||||| | || |||||||||| ||||||| ||||||||| |||||||||||||||||||    
46133396 ttctctggtggaccggaggttaggagtgcccttctgatttggtgctgaagtctggtgagccgatcgcttttgatttgagatcgggagtcagttct 46133302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 6716830 - 6716759
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||| ||  ||| ||||||| |||||||||||||||||||||||||||||||||||||||    
6716830 ggtgcccttctgatttaatcataaagtctggttggccgatcacttttgattcgagatcgggagtcagttctt 6716759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 34389950 - 34390020
Alignment:
35 gtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||||||| || ||| |||||||||||||||||||||||||||||||||||||||||| ||||    
34389950 gtgccctgctgatttggttttaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctctt 34390020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 59 - 104
Target Start/End: Original strand, 10244195 - 10244240
Alignment:
59 tctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
10244195 tctggtgggccgatcacttttgattcgagatcgggagtcagttctt 10244240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 32 - 111
Target Start/End: Original strand, 12480871 - 12480951
Alignment:
32 gaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||| |||||||||||  | || |||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||    
12480871 gaggtggccttctgattttgtcctgaagtttggtgggccgatcgcttttgattcgagatcgggagtcagttctttggttca 12480951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 3478339 - 3478410
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||| |||| | |||| || |||||||||||||||||||||||||||||||||||| |||||||    
3478339 ggtgcccttctgttttggtcctaaagtttggtgggccgatcacttttgattcgagatcgggagttagttctt 3478410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 56 - 103
Target Start/End: Original strand, 9349759 - 9349806
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||    
9349759 aagtctggtgggccgatcacttttgattcgagatcgggagtcaattct 9349806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 38306272 - 38306319
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||    
38306272 agtctggtgggccgatcacttttgattcgagattgggagtcagttctt 38306319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 34 - 102
Target Start/End: Original strand, 8745140 - 8745209
Alignment:
34 ggtgcccttctgatttgattctaagt-ctggtgggccgatcacttttgattcgagatcgggagtcagttc 102  Q
    |||| |||||||||||| | |||| | ||||||||||||||||||||||||||||||||||| |||||||    
8745140 ggtggccttctgatttggtcctaaattctggtgggccgatcacttttgattcgagatcgggattcagttc 8745209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 9428175 - 9428122
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttc 110  Q
    ||||||||| |||||||||||||||||||||||| | |||||||||||||||||    
9428175 agtctggtgagccgatcacttttgattcgagatcagaagtcagttcttcggttc 9428122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 34 - 98
Target Start/End: Complemental strand, 42533346 - 42533281
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||| |||||||| | |||| ||||||||||| |||||||||||||||||||||||||||||    
42533346 ggtgccctcctgatttggtcctaaagtctggtgggctgatcacttttgattcgagatcgggagtca 42533281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 33435119 - 33435167
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||| | ||||||||||||||||||||||||||||||||||||    
33435119 aagtctggtgagacgatcacttttgattcgagatcgggagtcagttctt 33435167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 24324892 - 24324821
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| |  ||| || |||||||||||||| ||||||||||||||||||||||| |||||    
24324892 ggtgcccttctgatttggtcttaaagtttggtgggccgatcaattttgattcgagatcgggagtcaattctt 24324821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 11379197 - 11379143
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||| ||||||| |||||||||||||||||||||||||| ||| ||||||    
11379197 agtctggtgagccgatcgcttttgattcgagatcgggagtcagtactttggttca 11379143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 152 - 222
Target Start/End: Original strand, 38485665 - 38485734
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgat 222  Q
    ||||| |||||||||||||||| |||||||| || |||||| ||||||| |||||||||| ||||||||||    
38485665 gttgcacggtggtggaagctgaatgatctttagagaaggag-ttcttcagatgtggctcattgttggtgat 38485734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 46262189 - 46262151
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||||||||||||||||    
46262189 agtctggtgggccgatcacttttgattcgagatcgggag 46262151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 1320804 - 1320852
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||| | ||||| |||||||||||    
1320804 aagtctggtgggccgatcacttttgattcaaaatcggaagtcagttctt 1320852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 3419727 - 3419679
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| |||||||| |||||||||||||||||||||||||||||| ||||    
3419727 aagtgtggtgggctgatcacttttgattcgagatcgggagtcagctctt 3419679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 25 - 104
Target Start/End: Original strand, 16954631 - 16954711
Alignment:
25 gaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| || ||||||||||||||||| | |||| ||||||| | ||||||||||||| ||||||||||  |||||||||||    
16954631 gaggtgaggggtgcccttctgatttggtcctaaagtctggttgaccgatcacttttgtttcgagatcgaaagtcagttctt 16954711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 41089819 - 41089771
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| |||||||||||||||||||||| ||||||||| ||||    
41089819 aagtctggtggaccgatcacttttgattcgagattgggagtcagctctt 41089771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 104
Target Start/End: Complemental strand, 47457141 - 47457045
Alignment:
9 attctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| ||||||| ||| |||||| ||||||| ||||||| | | || ||||||| ||| |||||| ||||||||| ||||| ||||||||||||||    
47457141 attctctggtggatcgggggtaaggggtgcccgtctgattaggtcctgaagtctgatggaccgatcgcttttgatttgagattgggagtcagttctt 47457045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 3867131 - 3867174
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| ||||||||||||||||||| |||||||||||||||    
3867131 tggtgggctgatcacttttgattcgagaccgggagtcagttctt 3867174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 16829030 - 16828959
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| ||||||| ||| ||||||||||| ||||||||||  |||||||||||    
16829030 ggtgcccttctgatttggtcctaaagtctggttggctgatcacttttgtttcgagatcgaaagtcagttctt 16828959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 37795004 - 37795047
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||| ||| |||||||||||||||||||||||||||||    
37795004 tggtgggccgttcagttttgattcgagatcgggagtcagttctt 37795047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 47325955 - 47325908
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| ||||||||| ||||||||||||||| ||||    
47325955 agtctggtgggccgatcgcttttgatttgagatcgggagtcagctctt 47325908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 92
Target Start/End: Complemental strand, 17802885 - 17802851
Alignment:
58 gtctggtgggccgatcacttttgattcgagatcgg 92  Q
    |||||||||||||||||||||||||||||||||||    
17802885 gtctggtgggccgatcacttttgattcgagatcgg 17802851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 27993606 - 27993568
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||| ||||||||||||||||||||||||||||    
27993606 agtctggtggaccgatcacttttgattcgagatcgggag 27993568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 35206763 - 35206725
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||| ||||||||||||    
35206763 agtctggtgggccgatcacttttgatccgagatcgggag 35206725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 83
Target Start/End: Original strand, 44755613 - 44755663
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgatt 83  Q
    ||||||||||||||||| | |||| ||||||||||||||||||||||||||    
44755613 ggtgcccttctgatttggtcctaaagtctggtgggccgatcacttttgatt 44755663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 98
Target Start/End: Original strand, 25160802 - 25160867
Alignment:
34 ggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||| || ||||| ||||| |||||||||| ||||| ||||||||||||||||||| |||||    
25160802 ggtgccctgctaatttggttctatagtctggtggaccgattacttttgattcgagatcggaagtca 25160867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 68 - 104
Target Start/End: Complemental strand, 44353623 - 44353587
Alignment:
68 ccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||| ||||||||||||||||||||    
44353623 ccgatcacttttgatttgagatcgggagtcagttctt 44353587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 5860358 - 5860311
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| |||||||| ||| |||||||||||||||||||||||| |||||    
5860358 agtccggtgggcctatcgcttttgattcgagatcgggagtcaattctt 5860311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 98
Target Start/End: Original strand, 23983205 - 23983247
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||||||| |||||  |||||||||||||||||||||||    
23983205 aagtctggtgggtcgatcgtttttgattcgagatcgggagtca 23983247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 91
Target Start/End: Original strand, 25153231 - 25153265
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcg 91  Q
    |||||||||| ||||||||||||||||||||||||    
25153231 agtctggtggaccgatcacttttgattcgagatcg 25153265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 35745898 - 35745856
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    ||||||| ||||| ||||||||||||||||||||||| |||||    
35745898 aagtctgatgggctgatcacttttgattcgagatcggaagtca 35745856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 101
Target Start/End: Complemental strand, 48058725 - 48058680
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||| ||||| ||||||||| |||||||| ||||||||    
48058725 aagtctggtgggtcgatcgcttttgatttgagatcggaagtcagtt 48058680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 105
Target Start/End: Complemental strand, 26386265 - 26386197
Alignment:
38 cccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttc 105  Q
    |||||||||||||||| |  |||  ||||| |||||| ||||||||||||||||||||||  |||||||    
26386265 cccttctgatttgattttggagttcggtggtccgatcgcttttgattcgagatcgggagttcgttcttc 26386197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 32)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 9 - 111
Target Start/End: Original strand, 17033548 - 17033651
Alignment:
9 attctatggtggaccggaggtaagaggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcgg 107  Q
    ||||||||||| ||||   ||| | ||||||||||||||||| | ||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||    
17033548 attctatggtgaaccgagagtagggggtgcccttctgatttggtcctatagtctggtgggccgatcacttttgaatcgagatcgggagtcagttctttgg 17033647  T
108 ttca 111  Q
    ||||    
17033648 ttca 17033651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 99
Target Start/End: Complemental strand, 46814585 - 46814495
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcag 99  Q
    |||| ||||| ||||| || ||| |||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||    
46814585 ttctctggtgtaccgggggcaaggggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcag 46814495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 10 - 100
Target Start/End: Original strand, 4651743 - 4651834
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctga-tttgattctaagtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||| ||||| ||||| |||||| ||||||||||||| |||| | | |||||||| ||||||||||||||||||||||||||||||||||||    
4651743 ttctctggtgtaccgggggtaaggggtgcccttctgaatttgttccgaagtctggggggccgatcacttttgattcgagatcgggagtcagt 4651834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 34 - 98
Target Start/End: Original strand, 7857640 - 7857705
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||    
7857640 ggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtca 7857705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 9313383 - 9313312
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| |||| |||||| |||||||||||||||||||||||||||||||||||    
9313383 ggtgcccttctgatttggtcctaaagtctagtgggctgatcacttttgattcgagatcgggagtcagttctt 9313312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 24658916 - 24658987
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||| ||||    
24658916 ggtgccctgctgatttggttctaaagtctggtgggccaatcacttttgattcgagatcgggagtcagctctt 24658987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 27031958 - 27031863
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||| || ||| |||||||| |||||||| |||||| |||| ||||||||||||||||||||||||||||| ||||||| ||||    
27031958 ttctctggtgtaccgggggaaaggggtgccctgctgatttggttctaaagtctagtgggccgatcacttttgattcgagatcgagagtcagctctt 27031863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 31585830 - 31585783
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
31585830 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 31585783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 41920463 - 41920510
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
41920463 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 41920510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 38544809 - 38544756
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggtt 109  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
38544809 aagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctttggtt 38544756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 9 - 104
Target Start/End: Original strand, 19598598 - 19598694
Alignment:
9 attctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| ||||||||||  |||||| ||||||| |||| || | | || |||||||||||||||||| ||||||||||||||||| ||||||||||||    
19598598 attctctggtggaccgagggtaaggggtgcccgtctggttgggtcctgaagtctggtgggccgatcgcttttgattcgagatcgagagtcagttctt 19598694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 24684572 - 24684501
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| || |||||||||||| |||||||||||||||||||||| ||||||||||||  ||||||||||    
24684572 ggtgccctactaatttgattctaaagtctggtgggccgatcacttttaattcgagatcggatgtcagttctt 24684501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 46692889 - 46692842
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||    
46692889 agtctggtgggccgatcacttttgattcgagatcgggagttagttctt 46692842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 5459172 - 5459213
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    ||||||||||||||||||||||||||||||||||||||||||    
5459172 agtctggtgggccgatcacttttgattcgagatcgggagtca 5459213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 45 - 101
Target Start/End: Complemental strand, 15840995 - 15840938
Alignment:
45 gatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||    
15840995 gatttgtttctagagtctggtgggctgatcacttttgattcgagatcgggagtcagtt 15840938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 101
Target Start/End: Original strand, 34774858 - 34774925
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||||||||| | |||| ||||||||| |||||||||||||| |||||||||||||||||||    
34774858 ggtgcccttctgatttggtcctaacgtctggtggaccgatcacttttga-tcgagatcgggagtcagtt 34774925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 152 - 223
Target Start/End: Original strand, 4651889 - 4651959
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatg 223  Q
    |||||||||||||||||||||| |||||||| || |||||| ||||||  |||||||||| |||||||||||    
4651889 gttgcgcggtggtggaagctgaatgatctttagagaaggag-ttcttcggatgtggctcattgttggtgatg 4651959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 65 - 104
Target Start/End: Complemental strand, 5389483 - 5389444
Alignment:
65 gggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||    
5389483 gggccgatcacttttgattcgagatcgggagtcagttctt 5389444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 6583310 - 6583239
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||| |||||||||| | |||| ||||||||| ||||||||||||||||||||||||| ||||| |||||    
6583310 ggtgcctttctgatttggtcctaaagtctggtggaccgatcacttttgattcgagatcggcagtcaattctt 6583239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 65 - 104
Target Start/End: Original strand, 27102210 - 27102249
Alignment:
65 gggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||    
27102210 gggccgatcacttttgattcgagatcgggagtcagttctt 27102249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 30685974 - 30685927
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| ||||||||||||||||||||| ||||||||||||||||||||    
30685974 agtcttgtgggccgatcacttttgatttgagatcgggagtcagttctt 30685927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 101
Target Start/End: Original strand, 30655571 - 30655615
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||    
30655571 agtctagtgggccgatcgcttttgattcgagatcgggagtcagtt 30655615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 104
Target Start/End: Complemental strand, 24449996 - 24449953
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||| |||||||| |||||||||||    
24449996 tggtgggccgatcacttttgatttgagatcggaagtcagttctt 24449953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 46603403 - 46603457
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||  || ||||||||||||||||| |||||||||||| ||||||    
46603403 agtctggtgggccattcgcttttgattcgagatcgagagtcagttctttggttca 46603457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 2988090 - 2988019
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    |||| ||||||||||||||||| |||||||| |  |||||| ||||||  ||||||||| |||||||||||||    
2988090 gttgtgcggtggtggaagctgaatgatctttagggaaggag-ttcttcggatgtggctcggtgttggtgatga 2988019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 27905422 - 27905470
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| ||||||||||||||||||||||| | ||| |||||||    
27905422 aagtctggtggaccgatcacttttgattcgagatcagaagttagttctt 27905470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 32864655 - 32864584
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||| |||||| | |||| | |||||||||| ||||||||| |||||||||||| |||| ||||||    
32864655 ggtgcccttccgatttggtcctaaaggctggtgggccaatcacttttaattcgagatcggaagtcggttctt 32864584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 50589325 - 50589230
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| |||||||| || |||||| ||||||| |||| || | | || ||||| ||||||| |||| |||||||||||| |||||||| ||||||||    
50589325 ttctctggtggactgggggtaaggggtgcccgtctggttgggtcctgaagtccggtgggctgatcgcttttgattcgaaatcgggagccagttctt 50589230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 38564912 - 38564950
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    ||||| ||||||||||| |||||||||||||||||||||    
38564912 agtctcgtgggccgatcgcttttgattcgagatcgggag 38564950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 42374175 - 42374217
Alignment:
58 gtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    ||||||||| |||||| ||||||||| ||||||||||||||||    
42374175 gtctggtggaccgatcgcttttgatttgagatcgggagtcagt 42374217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 100
Target Start/End: Original strand, 42374049 - 42374090
Alignment:
59 tctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||||||| ||| | |||||||||||||||||||||||||||    
42374049 tctggtggaccggttacttttgattcgagatcgggagtcagt 42374090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 33034716 - 33034672
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||| ||||||||| |||||||||||||  ||||||||    
33034716 agtctggtgggtcgatcacttctgattcgagatcgaaagtcagtt 33034672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 24)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 103
Target Start/End: Original strand, 31721640 - 31721734
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    |||| ||||||||||| |||||| |||||||||||||| || |||| ||||||  |||||||||| |||||||||||||||||||||||||||||    
31721640 ttctctggtggaccgggggtaaggggtgcccttctgatgtggttctgaagtctaatgggccgatcgcttttgattcgagatcgggagtcagttct 31721734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 7392125 - 7392054
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| ||||||||| |||||||||||||||||||||||||||||||||||||    
7392125 ggtgcccttctgatttggtcctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagttctt 7392054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 34378108 - 34378156
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
34378108 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 34378156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 34 - 111
Target Start/End: Complemental strand, 39184281 - 39184203
Alignment:
34 ggtgcccttctgatttgattctaag-tctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||||||||  |  | |||||||||||||||||||||||||||||||||| ||||||||||| ||||||    
39184281 ggtgcccttctgatttgatcatgtggtctggtgggccgatcacttttgattcgagatcggaagtcagttctttggttca 39184203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 13954351 - 13954263
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||| ||||| |||| |||| || |||||| |||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||    
13954351 ttctctggtgtaccgaaggtgaggggtgcc-ttctgatttggtcctaaagtctggtgggccgatcacttttgattcgagatcgggagtca 13954263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 10 - 110
Target Start/End: Complemental strand, 33259000 - 33258899
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggt 108  Q
    |||| ||||| |||| |||| || |||| ||||||| |||| | |||| ||||||||||||||||||||||||||||||||| ||||| ||||||| |||    
33259000 ttctctggtgtaccgaaggtgaggggtgtccttctgttttggtgctaaagtctggtgggccgatcacttttgattcgagatcaggagttagttctttggt 33258901  T
109 tc 110  Q
    ||    
33258900 tc 33258899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 7195310 - 7195262
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||    
7195310 aagtctggtgagccgatcacttttgattcgagatcgggagtcagttctt 7195262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 56 - 106
Target Start/End: Original strand, 23426354 - 23426404
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcg 106  Q
    ||||||||||| |||| ||||||||||||||||| ||||||||||||||||    
23426354 aagtctggtggaccgaacacttttgattcgagattgggagtcagttcttcg 23426404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 111
Target Start/End: Complemental strand, 24072360 - 24072282
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||||||||| | |||| ||||||| ||| |||| ||||||||| |||||||| ||||||||||| ||||||    
24072360 ggtgcccttctgatttggtcctaaagtctggttggctgatcgcttttgatttgagatcggaagtcagttctttggttca 24072282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 44 - 99
Target Start/End: Original strand, 12046252 - 12046308
Alignment:
44 tgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcag 99  Q
    |||||||||||  |||| |||||||||||||||||||||||||||||||||| ||||    
12046252 tgatttgattcggaagtttggtgggccgatcacttttgattcgagatcgggactcag 12046308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 22675395 - 22675347
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| ||||||  |||||||||||||||||||||||||||||    
22675395 aagtctggtggaccgatcgattttgattcgagatcgggagtcagttctt 22675347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 25992017 - 25992065
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||| ||| ||||||||||||||||| ||||||||||||    
25992017 aagtctggtgggccaatcgcttttgattcgagatcgagagtcagttctt 25992065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 8297455 - 8297526
Alignment:
34 ggtgcccttctgatttgattctaagtc-tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| ||||||  | ||||||||  || | |||||||||||||||||||||||||||||    
8297455 ggtgcccttctgatttggttctaaagcatggtgggctaataatttttgattcgagatcgggagtcagttctt 8297526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 112
Target Start/End: Original strand, 8730928 - 8730983
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttcag 112  Q
    |||||||||| || ||| ||||| |||||||||||||||||||||||| |||||||    
8730928 agtctggtggacctatcgcttttaattcgagatcgggagtcagttctttggttcag 8730983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 61 - 104
Target Start/End: Complemental strand, 21402903 - 21402860
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||||  |||||||||||||||||||||||    
21402903 tggtgggccgatcacttttagttcgagatcgggagtcagttctt 21402860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 698372 - 698413
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||||| |||||| ||||||||||||||||||||||||    
698372 agtctggtggaccgatctcttttgattcgagatcgggagtca 698413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 104
Target Start/End: Complemental strand, 14302522 - 14302453
Alignment:
36 tgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||| |||| | |||| ||||||||| | ||||||||||| |||||||| ||||||||||||||    
14302522 tgcccttctgttttggtcctaaagtctggtggactgatcacttttggttcgagattgggagtcagttctt 14302453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 111
Target Start/End: Complemental strand, 17854180 - 17854083
Alignment:
15 tggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||| ||| || ||||||||||| ||||| |  | |||| ||||||||||| | ||||||| |||||||||||||||| || || ||||||    
17854180 tggtggaccgggggtgaggggtgcccttctaatttggtcttgaagtatggtgggccgaccgcttttgactcgagatcgggagtcaattatttggttca 17854083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 104
Target Start/End: Original strand, 18593260 - 18593301
Alignment:
63 gtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||| ||||||||||||||||||||||||||| |||||||    
18593260 gtgggcagatcacttttgattcgagatcgggagttagttctt 18593301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 96
Target Start/End: Complemental strand, 26046035 - 26045995
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagt 96  Q
    ||||||||||  |||||||||||||||||||||||||||||    
26046035 aagtctggtgaaccgatcacttttgattcgagatcgggagt 26045995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 27713079 - 27713127
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||| |||||||||||  ||||||||||||||||||| |||||||||    
27713079 aagtctagtgggccgatcgtttttgattcgagatcgggaatcagttctt 27713127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 29087491 - 29087539
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| | |||| |||||||||||||||| |||||||||||||    
29087491 aagtctggtggactgatcccttttgattcgagatcaggagtcagttctt 29087539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 111
Target Start/End: Complemental strand, 39024544 - 39024466
Alignment:
34 ggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||||| ||| | || |||| ||||||  | ||| |||||||||||||||||||||||| ||||| ||||||    
39024544 ggtgcccttctgagttggtcctgaagtttggtggctcaatcgcttttgattcgagatcgggagtcacttctttggttca 39024466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 25341709 - 25341741
Alignment:
57 agtctggtgggccgatcacttttgattcgagat 89  Q
    ||||||||||||||||||||||||||| |||||    
25341709 agtctggtgggccgatcacttttgatttgagat 25341741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 19370 - 19441
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||| |||||||||||    
19370 ggtgcccttctgatttggtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctt 19441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 38)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 10 - 104
Target Start/End: Complemental strand, 53823539 - 53823444
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||||||| || ||||||||||||||||| |  ||| ||||||||| || ||||||||||||||||||||||||||||||||||    
53823539 ttctctggtgtaccggaggtgaggggtgcccttctgatttggtcataaagtctggtggaccaatcacttttgattcgagatcgggagtcagttctt 53823444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 104
Target Start/End: Original strand, 25753135 - 25753230
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||||||| ||  |||||| ||| ||||| | |||| |||||||||| ||||||||||||||||||||||||||||||||||||    
25753135 ttctctggtgtaccggaggtgaggagtgcccgtcttatttggtcctaaagtctggtggggcgatcacttttgattcgagatcgggagtcagttctt 25753230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 104
Target Start/End: Original strand, 35800453 - 35800547
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||||| ||| |||||| ||||||||||||||||| |||| ||||||||||  |||||| |||||||||||||||||| |||||||||||    
35800453 ttctctggtggatcgg-ggtaagtggtgcccttctgatttggttctgaagtctggtgaaccgatcgcttttgattcgagatcggaagtcagttctt 35800547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 34 - 111
Target Start/End: Complemental strand, 46698879 - 46698801
Alignment:
34 ggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||||||||| | ||  ||||||||||||||||  |||||||||||||||||||||||||||||| ||||||    
46698879 ggtgcccttctgatttggtcctgtagtctggtgggccgattgcttttgattcgagatcgggagtcagttctttggttca 46698801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 34 - 109
Target Start/End: Complemental strand, 31050756 - 31050680
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggtt 109  Q
    |||||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||| ||| || |||| ||||    
31050756 ggtgccctactgatttggttctaaagtctggtgggccgatcacttttgattcgagatcggaagttaggtctttggtt 31050680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 9 - 104
Target Start/End: Original strand, 38929789 - 38929885
Alignment:
9 attctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| ||||||||||| |||||| ||||||| |||| || | | || ||||||| |||||||||||||||||||||||||||  ||||||||||||    
38929789 attctctggtggaccgggggtaaggggtgcccgtctggttgggtcctgaagtctgctgggccgatcacttttgattcgagatcaagagtcagttctt 38929885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 104
Target Start/End: Original strand, 4305688 - 4305783
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| ||||| ||||| || ||| |||||||| || ||||| | ||| ||||||||||| |||||||||||||||||||||||||||| |||||||    
4305688 ttctctggtgtaccgggggcaagcggtgccctgctaatttggtactatagtctggtggggcgatcacttttgattcgagatcgggagttagttctt 4305783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 101
Target Start/End: Complemental strand, 19311435 - 19311369
Alignment:
34 ggtgcccttctgatttgattctaagtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||| |||||||||||| || ||||||||||||| |||||||||||||||||||| ||||||||||||    
19311435 ggtgtccttctgatttggttttaagtctggtgggtcgatcacttttgattcgaga-cgggagtcagtt 19311369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 21387274 - 21387220
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||    
21387274 agtctggtggaccgatcacttttgattcgagatcggaagtcagttcttcgattca 21387220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 104
Target Start/End: Complemental strand, 22811253 - 22811183
Alignment:
35 gtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||| |  ||| ||||||||||||||||| |||| ||||||||||||||||||||||||    
22811253 gtgcccttctgatttggtcttaaagtctggtgggccgatcattttttattcgagatcgggagtcagttctt 22811183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 226
Target Start/End: Complemental strand, 43374065 - 43373992
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatgatg 226  Q
    ||||||||||||||||||||||||||||||| ||||| ||| ||||||| | ||| ||| |||||||||||||||    
43374065 gttgcgcggtggtggaagctgattgatctttagaaaatgag-ttcttcagaggtgactcggtgttggtgatgatg 43373992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 16501718 - 16501795
Alignment:
34 ggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttc 110  Q
    |||| ||||| |||||||| || |||| ||||||||||||| ||||||||||||||||||||||||| |||| |||||    
16501718 ggtggccttccgatttgatcctgaagtttggtgggccgatcgcttttgattcgagatcgggagtcagctctttggttc 16501795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 39041344 - 39041300
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||||||||||||||||||| ||||||||||    
39041344 agtctggtgggccgatcacttttgattcgagatcaggagtcagtt 39041300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 37 - 104
Target Start/End: Original strand, 49747517 - 49747585
Alignment:
37 gcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||| ||||||| |||||| |||||||| ||||||||||||||||| ||||||| ||||||||||||    
49747517 gcccttttgatttggttctaaagtctggtgagccgatcacttttgatttgagatcgagagtcagttctt 49747585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 2061832 - 2061761
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||  ||||||||| |||| ||||||||||| |||||||||||||||||||| | ||||||||||||    
2061832 ggtgccctcttgatttgatcctaaagtctggtgggctgatcacttttgattcgagattgagagtcagttctt 2061761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 38637302 - 38637255
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||||||||||||||||||||||||||||||||| |||||    
38637302 agtctggcgggccgatcacttttgattcgagatcgggagtcaattctt 38637255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 104
Target Start/End: Complemental strand, 19815337 - 19815247
Alignment:
15 tggtggaccggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| |||||| ||| || |||||||||||| |||| | |||| ||||||||| ||||| |||||| |||||||||| |||||||||||||    
19815337 tggttgaccgggggtgaggggtgcccttctgttttggtcctaaagtctggtggaccgattactttttattcgagatcaggagtcagttctt 19815247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 60 - 98
Target Start/End: Complemental strand, 39421080 - 39421042
Alignment:
60 ctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||||||||||||||||||||||||||||||||||    
39421080 ctggtgggccgatcacttttgattcgagatcgggagtca 39421042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 40813851 - 40813813
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||||||||||||||||    
40813851 agtctggtgggccgatcacttttgattcgagatcgggag 40813813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 8255037 - 8255085
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||| ||||||| | |||||||||||    
8255037 aagtctggtgggccgatcacttttgatccgagatcagaagtcagttctt 8255085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 8268455 - 8268503
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||| ||||||| | |||||||||||    
8268455 aagtctggtgggccgatcacttttgatccgagatcagaagtcagttctt 8268503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 92
Target Start/End: Original strand, 53756766 - 53756802
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgg 92  Q
    |||||||||||||||||||||||||||||||||||||    
53756766 aagtctggtgggccgatcacttttgattcgagatcgg 53756802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 6600015 - 6599968
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| ||||||||| ||||||||||||| ||||||    
6600015 agtctggtgggccgatcgcttttgattagagatcgggagtcggttctt 6599968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 12296145 - 12296240
Alignment:
17 gtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||| |||||| ||||||| |||| |||| | || |||||||||| ||||| | ||||||||||||||||   ||||||||||| ||||||    
12296145 gtggaccgggggtaaggggtgcccctctggtttggtcctgaagtctggtgtgccgagcgcttttgattcgagatcaaaagtcagttctttggttca 12296240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 100
Target Start/End: Complemental strand, 36962685 - 36962642
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||||||||||||||| ||||||||||||||||| |||||||||    
36962685 agtctggtgggccgattacttttgattcgagatcaggagtcagt 36962642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 94
Target Start/End: Original strand, 2825770 - 2825831
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcggga 94  Q
    ||||| || |||||||| |||||| ||| ||||||||||||| |||||||||||||||||||    
2825770 ggtgctctgctgatttggttctaaagtccggtgggccgatcatttttgattcgagatcggga 2825831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 30167628 - 30167587
Alignment:
63 gtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||| ||||||||||||||||||||||||||||| ||||||    
30167628 gtgggtcgatcacttttgattcgagatcgggagtcggttctt 30167587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 104
Target Start/End: Original strand, 30964454 - 30964499
Alignment:
59 tctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||| |||||||||||||||||||||| ||||||||||| ||||||    
30964454 tctgatgggccgatcacttttgattcgtgatcgggagtccgttctt 30964499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 90
Target Start/End: Complemental strand, 37707425 - 37707392
Alignment:
57 agtctggtgggccgatcacttttgattcgagatc 90  Q
    ||||||||||||||||||||||||||||||||||    
37707425 agtctggtgggccgatcacttttgattcgagatc 37707392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 2792344 - 2792300
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||| || ||||||||||||||||||||||||||| ||||||||    
2792344 agtctagtaggccgatcacttttgattcgagatcggaagtcagtt 2792300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 101
Target Start/End: Original strand, 26474851 - 26474891
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||||||||||||||||||||||| |||| ||||    
26474851 tggtgggccgatcacttttgattcgagatcgagagttagtt 26474891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 48098317 - 48098388
Alignment:
31 agaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||||| |  ||| | | | |||||| |||||||||| ||||||||||||||||||||    
48098317 agaggtgcccttctgatttggtcataaagcccgatgggcctatcacttttgtttcgagatcgggagtcagtt 48098388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 10388572 - 10388610
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    ||||| ||||||||||||||||||||||||| |||||||    
10388572 agtcttgtgggccgatcacttttgattcgaggtcgggag 10388610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 59 - 96
Target Start/End: Original strand, 12296061 - 12296098
Alignment:
59 tctggtgggccgatcacttttgattcgagatcgggagt 96  Q
    |||||||||||||| ||||||| |||||||||||||||    
12296061 tctggtgggccgattacttttgcttcgagatcgggagt 12296098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 111
Target Start/End: Complemental strand, 24740172 - 24740119
Alignment:
58 gtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||||| ||| | |||| |||||||||||||||| || ||||||    
24740172 gtctggtgggccgatcgcttataattcaagatcgggagtcagttatttggttca 24740119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 95
Target Start/End: Complemental strand, 17416573 - 17416541
Alignment:
63 gtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||||| ||||    
17416573 gtgggccgatcacttttgattcgagatcaggag 17416541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 28966877 - 28966925
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||| || |||||  |||||||||||||| ||||||||||||||    
28966877 aagtctggtagggcgatcgtttttgattcgagattgggagtcagttctt 28966925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 224
Target Start/End: Original strand, 35800603 - 35800670
Alignment:
156 cgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    ||||||||||||| |||| |||||||||| ||||||| |||||   |||||||||  ||||||||||||    
35800603 cgcggtggtggaacctgaatgatctttggtaaaggag-ttctttggatgtggctcgttgttggtgatga 35800670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 32)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 19176489 - 19176560
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| || ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
19176489 ggtgccctgctaatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 19176560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 17550968 - 17551015
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
17550968 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 17551015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 10 - 111
Target Start/End: Complemental strand, 30935508 - 30935406
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggt 108  Q
    |||| ||||||||||| |||||| ||||||||||||||||| || | |||| |||||||| |||| |||||||||| ||||||||||| |||| || |||    
30935508 ttctctggtggaccgggggtaaggggtgcccttctgatttggttttgaagtttggtgggctgatcgcttttgattcaagatcgggagttagttatttggt 30935409  T
109 tca 111  Q
    |||    
30935408 tca 30935406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 14755336 - 14755283
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggtt 109  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
14755336 aagtctggtgggccgatcacttttgattcaagatcgggagtcagttctttggtt 14755283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 102
Target Start/End: Original strand, 14879422 - 14879491
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttc 102  Q
    ||||||||||||||| | | |||| |||||||||||||||||||||||||||||||||||||||| ||||    
14879422 ggtgcccttctgattgggtcctaaagtctggtgggccgatcacttttgattcgagatcgggagtctgttc 14879491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 98
Target Start/End: Complemental strand, 34475848 - 34475783
Alignment:
34 ggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||    
34475848 ggtgccctgctaatttgtttctatagtctggtgggccgatcacttttgattcgagatcgggagtca 34475783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 43012385 - 43012433
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||    
43012385 aagtctggtggcccgatcacttttgattcgagatcgggagtcagttctt 43012433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 9584147 - 9584076
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| || ||||||| |||| |||||||||  ||||||||||||||||||||||||||||||||||||    
9584147 ggtgccctgctaatttgatactaaagtctggtggatcgatcacttttgattcgagatcgggagtcagttctt 9584076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 5556581 - 5556635
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||    
5556581 agtctggtggggcgatcgcttttgattcgagatcgggagtcagttctttggttca 5556635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 101
Target Start/End: Original strand, 47945667 - 47945761
Alignment:
9 attctatggtggacc-ggaggtaagaggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||| ||||||||| || |||||| ||||||| |||| || | | |||| ||| ||||||||||||||||||||||||||||||||||||||||    
47945667 attctctggtggaccagggggtaaggggtgcccgtctggttgggtcctaaagtccggtgggccgatcacttttgattcgagatcgggagtcagtt 47945761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 55 - 104
Target Start/End: Complemental strand, 33144021 - 33143972
Alignment:
55 taagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||    
33144021 taagtctggtggatcgatcacttttgattcgagatcgggagtcagttctt 33143972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 156 - 224
Target Start/End: Complemental strand, 30935356 - 30935289
Alignment:
156 cgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    |||||||||||||||||| |||||||| ||||||||| ||||||  ||||||||| |||||||||||||    
30935356 cgcggtggtggaagctgaatgatctttagaaaaggag-ttcttcggatgtggctcggtgttggtgatga 30935289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 14193927 - 14193998
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| |||||| || |||||||||||||||||||||| ||||||| ||||||    
14193927 ggtgcccttctgatttggtcctaaagtctggcggaccgatcacttttgattcgagattgggagtcggttctt 14193998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 20710779 - 20710740
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    ||||||||||||||||||||||||||||||||||||||||    
20710779 aagtctggtgggccgatcacttttgattcgagatcgggag 20710740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 61 - 104
Target Start/End: Original strand, 37123397 - 37123440
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||||| ||||||||||||||    
37123397 tggtgggccgatcacttttgattcgagattgggagtcagttctt 37123440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 61 - 104
Target Start/End: Complemental strand, 39021342 - 39021299
Alignment:
61 tggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||||||||||| ||||||||||||||||    
39021342 tggtgggccgatcacttttgattcgaggtcgggagtcagttctt 39021299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 45398783 - 45398854
Alignment:
34 ggtgcccttctgatttg-attctaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| |||  ||||||||||| |||||||||||||||||||||||| ||||||| ||||    
45398783 ggtgccctgctgatttggatttaaagtctggtggaccgatcacttttgattcgagatcgagagtcagctctt 45398854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 103
Target Start/End: Original strand, 30127273 - 30127319
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||    
30127273 agtctggtgagccgatcgcttttgattcgagatcgggagtcagttct 30127319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 39 - 111
Target Start/End: Complemental strand, 1652975 - 1652902
Alignment:
39 ccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||| | || || ||| |||||||||||||||||||||||||||| ||||| ||||||| ||||||    
1652975 ccttctgatttggtcctgaactcttgtgggccgatcacttttgattcgagatcaggagttagttctttggttca 1652902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 97
Target Start/End: Complemental strand, 40023643 - 40023602
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtc 97  Q
    ||||||||||| ||||||||||||||||||||||||||||||    
40023643 aagtctggtggaccgatcacttttgattcgagatcgggagtc 40023602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 20611801 - 20611841
Alignment:
64 tgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| |||||||||||||||||||||||||||||    
20611801 tgggccgatcatttttgattcgagatcgggagtcagttctt 20611841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 24099397 - 24099353
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||||||||||||||| ||||||| ||||||    
24099397 agtctggtgggccgatcacttttgattcgatatcgggaatcagtt 24099353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 96
Target Start/End: Complemental strand, 23328444 - 23328381
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagt 96  Q
    ||||||||  ||||||| |||||| || |||||| |||||||||||||||||||||||||||||    
23328444 ggtgccctgttgatttggttctaaagtttggtggaccgatcacttttgattcgagatcgggagt 23328381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 96
Target Start/End: Original strand, 25647671 - 25647734
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagt 96  Q
    ||||||||||||||||| | |||| |||||  ||||| ||||||||||||||||||||||||||    
25647671 ggtgcccttctgatttggtcctaaagtctgacgggcctatcacttttgattcgagatcgggagt 25647734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 64 - 101
Target Start/End: Complemental strand, 823498 - 823461
Alignment:
64 tgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||||||||||||| |||||||||    
823498 tgggccgatcacttttgattcgagatcgagagtcagtt 823461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 104
Target Start/End: Complemental strand, 2392573 - 2392529
Alignment:
60 ctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||||||||||||||||||||| || |||||||||||    
2392573 ctggtggaccgatcacttttgattcgagattggaagtcagttctt 2392529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 104
Target Start/End: Complemental strand, 2394320 - 2394276
Alignment:
60 ctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||||||||||||||||||||| || |||||||||||    
2394320 ctggtggaccgatcacttttgattcgagattggaagtcagttctt 2394276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 100
Target Start/End: Original strand, 31424247 - 31424290
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagt 100  Q
    |||||||| ||||| || ||||||||||||||||||||||||||    
31424247 agtctggtaggccggtcgcttttgattcgagatcgggagtcagt 31424290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 101
Target Start/End: Original strand, 45163872 - 45163910
Alignment:
63 gtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||||||||||||| | ||||||||    
45163872 gtgggccgatcacttttgattcgagatcagaagtcagtt 45163910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 94
Target Start/End: Original strand, 31482895 - 31482932
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcggga 94  Q
    ||||||| |||| |||||||||||||||||||||||||    
31482895 agtctggcgggcggatcacttttgattcgagatcggga 31482932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 2782139 - 2782095
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||| |||||||||||||||  |||||||||| |||||    
2782139 agtctggtgggacgatcacttttgattttagatcgggagccagtt 2782095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 19295935 - 19295891
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||||||| |||||||||||||||| ||||| ||| ||||    
19295935 agtctggtgggcctatcacttttgattcgatatcggaagttagtt 19295891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 35)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 56 - 111
Target Start/End: Complemental strand, 22885204 - 22885149
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
22885204 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttggttca 22885149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 1269470 - 1269541
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||  | |||| ||||||||||||||||||||||||||||||||||| |||||||||||    
1269470 ggtgcccttctgatttagtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctt 1269541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 7874278 - 7874349
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||| ||||    
7874278 ggtgccctgctgatttggttctaaagtctggtgggtcgatcacttttgattcgagatcgggagtcagctctt 7874349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 31902532 - 31902438
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    |||| ||||||||||| ||| || |||| |||||| ||||||| || |||||||||||||| ||| ||||| |||||||||||||||||||||||    
31902532 ttctctggtggaccgggggttaggggtgtccttcttatttgatgctgaagtctggtgggccaatcgcttttaattcgagatcgggagtcagttct 31902438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 104
Target Start/End: Original strand, 14405195 - 14405256
Alignment:
44 tgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
14405195 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctctt 14405256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 56 - 112
Target Start/End: Complemental strand, 33788703 - 33788647
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttcag 112  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||    
33788703 aagtctggtgggccgatcgcttttgattcgagattgggagtcagttctttggttcag 33788647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 14106618 - 14106547
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| | |||| ||||||||||||||||||||||||||| |||||||||||||| ||||    
14106618 ggtgccctgctgatttggtcctaaagtctggtgggccgatcacttttgattcaagatcgggagtcagctctt 14106547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 39338935 - 39338888
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||    
39338935 agtctggtgggccgatcgcttttgattcgagatcgggagtcagttctt 39338888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 10524108 - 10524149
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    ||||||||||||||||||||||||||||||||||||||||||    
10524108 agtctggtgggccgatcacttttgattcgagatcgggagtca 10524149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 15126481 - 15126433
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||| |||||||||||||||||||||| ||||||    
15126481 aagtctggtgggccgatcatttttgattcgagatcgggagtcggttctt 15126433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 16959992 - 16960040
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||||| ||||||||||||||||| ||||||||||||    
16959992 aagtctggtgggccgatcgcttttgattcgagatcgagagtcagttctt 16960040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 4471934 - 4471981
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||    
4471934 agtctggtgggccgatcgcctttgattcgagatcgggagtcagttctt 4471981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 13337261 - 13337332
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||   ||| ||||| ||||||||||||||||||||||| ||||| |||||||||||    
13337261 ggtgcccttctgatttgaccttaaagtctgatgggccgatcacttttgattcgaaatcggaagtcagttctt 13337332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 103
Target Start/End: Original strand, 18681035 - 18681122
Alignment:
17 gtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttct 103  Q
    ||||||||| ||||||   ||||||||||||||| || | |||| ||||||||||||  | |||||||||||||||||||||||||||    
18681035 gtggaccgggggtaaggactgcccttctgatttggttatgaagtatggtgggccgattgcatttgattcgagatcgggagtcagttct 18681122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 57 - 95
Target Start/End: Complemental strand, 4162090 - 4162052
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||||||||||||||||||||||||||||||||||||||    
4162090 agtctggtgggccgatcacttttgattcgagatcgggag 4162052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 387183 - 387231
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||| |||||||||||||| |||||||||||||| |||||    
387183 aagtctggtgggctgatcacttttgatttgagatcgggagtcaattctt 387231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 12793702 - 12793631
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    |||| ||||||||||||||||| |||||||| || |||||| ||||||  ||||||||| |||||||||||||    
12793702 gttgtgcggtggtggaagctgaatgatctttagagaaggag-ttcttcggatgtggctcggtgttggtgatga 12793631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 104
Target Start/End: Original strand, 23650396 - 23650443
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||| |||| |||||||||||||||||||||||| |||||    
23650396 agtctggtgggctgatcgcttttgattcgagatcgggagtcatttctt 23650443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 112
Target Start/End: Complemental strand, 25504979 - 25504924
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttcag 112  Q
    |||||||||| || ||| ||||| |||||||||||||||||||||||| |||||||    
25504979 agtctggtggacctatcgcttttaattcgagatcgggagtcagttctttggttcag 25504924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 27739985 - 27740040
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||||||||||||||| |||||||||| |||||| ||||||||  |||||||||    
27739985 aagtctggtgggccgatcgcttttgattcaagatcgagagtcagtgtttcggttca 27740040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 2062901 - 2062947
Alignment:
58 gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    |||||||||||||||  ||||||||||||||||||||||||| ||||    
2062901 gtctggtgggccgattgcttttgattcgagatcgggagtcagctctt 2062947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 101
Target Start/End: Complemental strand, 10173649 - 10173604
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||| |||||||||||||||||||||||||||||| ||| ||||    
10173649 aagtctagtgggccgatcacttttgattcgagatcggaagtaagtt 10173604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 224
Target Start/End: Complemental strand, 915424 - 915353
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    |||||||||||||||||||| | |||| ||  ||||||||| ||||||  |||| ||||||||||||||||||    
915424 gttgcgcggtggtggaagctcaatgattttaagaaaaggag-ttcttcggatgttgctcagtgttggtgatga 915353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 111
Target Start/End: Original strand, 5254266 - 5254321
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggttca 111  Q
    |||||| ||||||||||||||||| ||| ||||||||||||| | |||| ||||||    
5254266 aagtctagtgggccgatcacttttaatttgagatcgggagtctgctctttggttca 5254321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 9560859 - 9560820
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggag 95  Q
    |||| |||||| ||||||||||||||||||||||||||||    
9560859 aagtttggtggaccgatcacttttgattcgagatcgggag 9560820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 57 - 92
Target Start/End: Complemental strand, 23665474 - 23665439
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgg 92  Q
    ||||| ||||||||||||||||||||||||||||||    
23665474 agtctagtgggccgatcacttttgattcgagatcgg 23665439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 37770735 - 37770664
Alignment:
34 ggtgcccttctgatttgattctaag-tctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||| ||||||||| | ||||| | ||||||||||||||||||||||||  |||| ||||||| |||||    
37770735 ggtgcccatctgatttggtcctaaggtttggtgggccgatcacttttgattctggatcaggagtcaattctt 37770664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 111
Target Start/End: Original strand, 29487094 - 29487195
Alignment:
10 ttctatggtggaccggaggtaagaggtgcccttctgatttgattct-aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggt 108  Q
    |||| |||||||| || ||| || ||||||| |||| ||||||  | ||||||||||| || ||| ||||||||||||||| |  |||||||||||||||    
29487094 ttctctggtggactgggggttaggggtgcccgtctggtttgatcttgaagtctggtgg-ccaatcgcttttgattcgagattgatagtcagttcttcggt 29487192  T
109 tca 111  Q
    |||    
29487193 tca 29487195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 36276241 - 36276200
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||||||| | || ||||||||||||||||||||||||    
36276241 agtctggtgggctgttcgcttttgattcgagatcgggagtca 36276200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 90
Target Start/End: Complemental strand, 41086882 - 41086825
Alignment:
34 ggtgcccttctgatttgattcta-agtctggtgggccgatcacttttgattcgagatc 90  Q
    ||||||||||||||||| |  || ||||||||||| | ||||||||||||||||||||    
41086882 ggtgcccttctgatttggtcatatagtctggtgggtcaatcacttttgattcgagatc 41086825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 104
Target Start/End: Original strand, 7695985 - 7696021
Alignment:
68 ccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||||| | |||||||||||||||    
7695985 ccgatcacttttgattcgataccgggagtcagttctt 7696021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 17105398 - 17105470
Alignment:
34 ggtgcccttctgatttgattct-aagtctggtgggccgatcac-ttttgattcgagatcgggagtcagttctt 104  Q
    |||||||| |||||||| | || ||||||| |||||||||||| |||||||||||||||| || |||| ||||    
17105398 ggtgccctactgatttggtactgaagtctgatgggccgatcactttttgattcgagatcgagaatcagatctt 17105470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 224
Target Start/End: Original strand, 18681175 - 18681246
Alignment:
152 gttgcgcggtggtggaagctgattgatctttggaaaaggagtttcttcaaatgtggctcagtgttggtgatga 224  Q
    ||||| |||||||| ||||||| |||||||| || |||||| | ||||  |||||||||| ||||||||||||    
18681175 gttgcacggtggtgaaagctgaatgatctttagagaaggagct-cttcggatgtggctcaatgttggtgatga 18681246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Complemental strand, 34143123 - 34143079
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    ||||||||| |||||||||||||| ||| ||||||| ||||||||    
34143123 agtctggtgagccgatcacttttgcttctagatcggaagtcagtt 34143079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 34230219 - 34230259
Alignment:
64 tgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||| |||| |||||||||| |||||||||||||    
34230219 tgggccgatcattttttattcgagatcaggagtcagttctt 34230259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Complemental strand, 42232 - 42161
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||  | |||| ||||||||||||||||||||||||||||||||||| |||||||||||    
42232 ggtgcccttctgatttagtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctt 42161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 104
Target Start/End: Original strand, 36694 - 36765
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 104  Q
    ||||||||||||||||| | |||| |||||| |||| |||||||||||||||||||||||||||||||||||    
36694 ggtgcccttctgatttggtcctaaagtctggcgggctgatcacttttgattcgagatcgggagtcagttctt 36765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1613 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold1613
Description:

Target: scaffold1613; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 56 - 109
Target Start/End: Complemental strand, 1088 - 1035
Alignment:
56 aagtctggtgggccgatcacttttgattcgagatcgggagtcagttcttcggtt 109  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||    
1088 aagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctttggtt 1035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 57 - 101
Target Start/End: Original strand, 3841 - 3885
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtcagtt 101  Q
    |||||||||||||||||| ||||||||||||||||||||||||||    
3841 agtctggtgggccgatcaattttgattcgagatcgggagtcagtt 3885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 89
Target Start/End: Original strand, 8140 - 8172
Alignment:
57 agtctggtgggccgatcacttttgattcgagat 89  Q
    ||||||||| |||||||||||||||||||||||    
8140 agtctggtgagccgatcacttttgattcgagat 8172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 35841 - 35800
Alignment:
57 agtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    ||||| ||||||||||||||||||||||||||||||||||||    
35841 agtctagtgggccgatcacttttgattcgagatcgggagtca 35800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 98
Target Start/End: Original strand, 58114 - 58179
Alignment:
34 ggtgcccttctgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtca 98  Q
    |||||||||| |||||| | |||| || |||||||||||||||||||||||| ||||||| |||||    
58114 ggtgcccttcagatttggtcctaaagtttggtgggccgatcacttttgattcaagatcggaagtca 58179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University