View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_75 (Length: 239)
Name: NF0713_low_75
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 43007077 - 43006939
Alignment:
Q |
1 |
ttcccttttcatataaccccttttcctttcctgaaacctagaaaacccaaaagcatcatcatattgatttgatgacctccattcttcttctcagaactct |
100 |
Q |
|
|
||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
43007077 |
ttcccttttcatagaacccattttccttccctgaaacctagaaaacccaaaagcatcatcatattgatttgatgacctccattcttcttctcataactct |
43006978 |
T |
 |
Q |
101 |
tctnnnnnnnncagattaaaattaagggttttttggctttg |
141 |
Q |
|
|
|| |||||||||||||||||||||||||||||| |
|
|
T |
43006977 |
cct--aaaaaacagattaaaattaagggttttttggctttg |
43006939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University