View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_low_76 (Length: 236)

Name: NF0713_low_76
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_low_76
NF0713_low_76
[»] chr8 (1 HSPs)
chr8 (13-215)||(8897123-8897325)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 8897123 - 8897325
Alignment:
13 aaggttttggttgtgaaaactgtagttagcgtcataacagcaattatgatgatgttctgaattgtgactttcaggattggactgggaggaggaacttgat 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
8897123 aaggttttggttgtgaaaactgtagttagcgtcataacagcaattatgatcatgttctgaattgtgactttcaggattggactgggaggaggaacttgat 8897222  T
113 ggaaagggagagctctctttttggcaatttgatttaggagtcaacatgtgatggaaaacattatcagctgagagtccaagttgttcatactgagccatga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8897223 ggaaagggagagctctctttttggcaatttgatttaggagtcaacatgtgatggaaaacattatcagctgagagtccaagttgttcatactgagccatga 8897322  T
213 ctg 215  Q
    |||    
8897323 ctg 8897325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University