View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_77 (Length: 236)
Name: NF0713_low_77
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_77 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 24 - 221
Target Start/End: Complemental strand, 8897112 - 8896915
Alignment:
| Q |
24 |
ctgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttggcaatgacttttgtcatgcttcaaatcatattaatagttgtggcaatgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8897112 |
ctgatttggatcatgcagtgcatgattctcctagtgctggtcagggttttggcaatgacttttgtcatgcttcaaatcatattaatagtcgtggcaatgt |
8897013 |
T |
|
| Q |
124 |
tggagaggttatttcaaatgcggttactaagaattcaagaacttctagtgatggtaggcgctatagtcatagtaattatgattatgattgtgatgatg |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8897012 |
tggagaggctatttcaaatgcggttactaagaattcaagaacttctagtgatggtaggcgctataatcatagtaattatgattatgattgtgatgatg |
8896915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University