View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_79 (Length: 228)
Name: NF0713_low_79
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0713_low_79 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 37228630 - 37228407
Alignment:
| Q |
1 |
ctgtgcaacaattaactaatcaaagtatatgttaaaggttgaaaattgctaaaggaagcttattgtttaccgaataacaaagtattcaaatctcaatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37228630 |
ctgtgcaacaattaactaatcaaagtatatgttaaaggttgaaaattgctaaaggaagcttattgtttaccgaataacaaagtattcaaatctcaatcta |
37228531 |
T |
 |
| Q |
101 |
tcatatatgacgatagggactgaattcagcaacagccacctttatacttcttactttatcattttagaaaattgaaaaccttaagttattacttgcagca |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37228530 |
tcatatatgaagatagggactgaattcagcaacagccacctttatacttctcactttatcattttagaaaattgaaaaccttaagttattacttgcagca |
37228431 |
T |
 |
| Q |
201 |
aacaaattgtattcctccatggtg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37228430 |
aacaaattgtattcctccatggtg |
37228407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 23429925 - 23429870
Alignment:
| Q |
162 |
ttttagaaaattgaaaaccttaagttattacttgcagcaaacaaattgtattcctc |
217 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||| ||||| ||||| |
|
|
| T |
23429925 |
ttttagaaaattgtgaaccttaaggtattacttgccgcaaacaagttgtactcctc |
23429870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University