View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0713_low_83 (Length: 223)

Name: NF0713_low_83
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0713_low_83
NF0713_low_83
[»] chr6 (1 HSPs)
chr6 (1-135)||(24104493-24104627)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 24104493 - 24104627
Alignment:
1 tactaaattttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagatttaacggcacacaa 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
24104493 tactaagttttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagacttaacggcacacaa 24104592  T
101 ttattttcttatgacttattgttatgttggtgatg 135  Q
    |||||||||||||||||||||||||||||||||||    
24104593 ttattttcttatgacttattgttatgttggtgatg 24104627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University