View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_83 (Length: 223)
Name: NF0713_low_83
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_83 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 24104493 - 24104627
Alignment:
Q |
1 |
tactaaattttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagatttaacggcacacaa |
100 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
24104493 |
tactaagttttttaactagagttaagtcactcgaccaggctaaacgcgtggtcgaggtaatgtctgaacttggtgtgccgttagacttaacggcacacaa |
24104592 |
T |
 |
Q |
101 |
ttattttcttatgacttattgttatgttggtgatg |
135 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
24104593 |
ttattttcttatgacttattgttatgttggtgatg |
24104627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University