View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0713_low_87 (Length: 211)
Name: NF0713_low_87
Description: NF0713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0713_low_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 28267602 - 28267414
Alignment:
Q |
1 |
ttattgtgtctctttggattgaggaatacgtgcataaacatcataatttatgattactttgaaatctatgtccatttaatatttcaaacgnnnnnnnn-g |
99 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | | |
|
|
T |
28267602 |
ttattgtgtctctttggattgaggaatacatgcataaacatcataatttatgattgctttgaaatctatgtccatttaatatttcaaaggaaaaaaaaag |
28267503 |
T |
 |
Q |
100 |
aaacaggaaagtacactaaagattaaagtgtcttggtatacttatgtttagataactctcatttgaatactgacctctggagtggttag |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28267502 |
aaacaggaaagtacactaaagattaaagtgtcttggtatacttatgtttagataactctcatttgaatactgacctctggagtggttag |
28267414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University