View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_high_26 (Length: 250)
Name: NF0714_high_26
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 35850952 - 35851137
Alignment:
| Q |
31 |
aggtccttttagatgttttagccgaatctttaaccttaagatatggaagagacgattccggggtcaaaggcaaaggggggacgcccttggagagggtcag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
35850952 |
aggtccttttagatgttttagccgaatctttaaccttaagatatggaagagacggttccggggtcaaaggcaaaggagg-acgcccttggagagggtcaa |
35851050 |
T |
|
| Q |
131 |
tgaaccctttatggaatattggcagtccaatcgttacttgatgatacacatgcaagtcatccgcattacttgaaaacattttcaaac |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
35851051 |
tgaaccctttatcgaatattggcagtccaatcgttatttgatgatacacatgcaagtcatccacattacctgaaaacatttgcaaac |
35851137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 43 - 210
Target Start/End: Original strand, 35853363 - 35853529
Alignment:
| Q |
43 |
atgttttagccgaatctttaaccttaagatatggaagagacgattccggggtcaaaggcaaaggggggacgcccttggagagggtcagtgaaccctttat |
142 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||| || |||| |||||||||| |||||| |||||||||||||| | || ||| ||||||| |
|
|
| T |
35853363 |
atgttttagccggatctttagccttaagatatgaaagaggcggttccagggtcaaaggaaaagggat-acgcccttggagagcgccaatgagtcctttat |
35853461 |
T |
|
| Q |
143 |
ggaatattggcagtccaatcgttacttgatgatacacatgcaagtcatccgcattacttgaaaacatt |
210 |
Q |
| |
|
||| |||||||||||| |||||| ||||||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
35853462 |
agaaaattggcagtccagtcgttatttgatgatacacatgcaagtcatccacattacctgaaaccatt |
35853529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 31 - 206
Target Start/End: Original strand, 35852055 - 35852228
Alignment:
| Q |
31 |
aggtccttttagatgttttagccgaatctttaaccttaagatatggaagagacgattccggggtcaaaggcaaaggggggacgcccttggagagggtcag |
130 |
Q |
| |
|
|||||||| |||||||||| || | ||| |||||||||||| ||||||||| || || ||||| ||| | ||| |||| || ||||||||||| | || |
|
|
| T |
35852055 |
aggtccttctagatgttttggctggatcattaaccttaagaaatggaagaggcggtttcgggggtaaaaggaaaaggggcacacccttggagagtgccaa |
35852154 |
T |
|
| Q |
131 |
tgaaccctttatggaatattggcagtccaatcgttacttgatgatacacatgcaagtcatccgcattacttgaaaa |
206 |
Q |
| |
|
||| |||||||||||| |||| |||||| ||||| ||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
35852155 |
tgagtcctttatggaat--tggcggtccaaacgttatttgatgatacacatgcaagtcatccacattactttaaaa |
35852228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 42392100 - 42392067
Alignment:
| Q |
1 |
agcttcttgaagtttatcttgccttttctaaggt |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
42392100 |
agcttcttgaagtttatcttgccttgtctaaggt |
42392067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 968 times since January 2019
Visitors: 4362