View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0714_high_32 (Length: 226)

Name: NF0714_high_32
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0714_high_32
NF0714_high_32
[»] chr8 (1 HSPs)
chr8 (1-143)||(7871428-7871570)


Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 7871570 - 7871428
Alignment:
1 tggattcatgagttttttccctatgatttagttagtcatggttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttggcagtagtggcat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7871570 tggattcatgagttttttccctatgatttagttagtcatggttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttggcagtagtggcat 7871471  T
101 tctttttacgcgtttttactttggtttacttgtgtgatgatgt 143  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
7871470 tctttttatgcgtttttactttggtttacttgtgtgatgatgt 7871428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University