View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0714_high_33 (Length: 210)

Name: NF0714_high_33
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0714_high_33
NF0714_high_33
[»] chr2 (1 HSPs)
chr2 (1-124)||(26351659-26351782)


Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 26351659 - 26351782
Alignment:
1 ttggatttgggttagatccactcactcactcactggctctcattaataagttaggtacttttagaaaaggcatagcattcttttctttgctcagttctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26351659 ttggatttgggttagatccactcactcactcactggctctcattaataagttaggtacttttagaaaaggcatagcattcttttctttgctcagttctca 26351758  T
101 tttcccacttttggttatgatgat 124  Q
    ||||||||||||||||||||||||    
26351759 tttcccacttttggttatgatgat 26351782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University