View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_high_33 (Length: 210)
Name: NF0714_high_33
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 26351659 - 26351782
Alignment:
| Q |
1 |
ttggatttgggttagatccactcactcactcactggctctcattaataagttaggtacttttagaaaaggcatagcattcttttctttgctcagttctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26351659 |
ttggatttgggttagatccactcactcactcactggctctcattaataagttaggtacttttagaaaaggcatagcattcttttctttgctcagttctca |
26351758 |
T |
|
| Q |
101 |
tttcccacttttggttatgatgat |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26351759 |
tttcccacttttggttatgatgat |
26351782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 998 times since January 2019
Visitors: 4362