View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_high_5 (Length: 423)
Name: NF0714_high_5
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 41 - 392
Target Start/End: Complemental strand, 2222707 - 2222349
Alignment:
| Q |
41 |
gttgctttttgtatacgtatatgagacatgagattgagatgacacgaagcatgtaaatggttgaggcagcacacgtttggaaatgaaagtgaaatcttaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222707 |
gttgctttttgtatacgtatatgagacatgagattgggatgacacgaagcatgtaaatagttgaggcagcacacgtttggaaatgaaagtgaaatcttaa |
2222608 |
T |
 |
| Q |
141 |
gcgtacatatgtctaaggatgttgggtaattcgaggtaaacgtggatggtttggatttctgttgttaatacgtggcgtcctattcagaatatcatgcttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222607 |
gcgtacatatgtctaaggatgttgggtaattcgaggtaaacgtggatggtttggatttgtgttgttaatacgtggcgtcctattcagaatatcatgcttt |
2222508 |
T |
 |
| Q |
241 |
tgacatgctgggaggaggggtagggatatttctttannnnnnnaattagt----------ttaattttgattagtagtaaatcggcgttttggttctcca |
330 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | | | ||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2222507 |
tgacatgctgg---gaggggtagggatatttctttattttatcagtgtttcattttctaattattttttattagtagtaaatcggcgttttggttctcca |
2222411 |
T |
 |
| Q |
331 |
agttatatatgagtcgagaaatttatttatttttagtcacctttcgaaagaaaaagaaaaag |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2222410 |
agttatatatgagtcgagaaatttatttatttttagtcacctttcgaaagaaaaaaaaaaag |
2222349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University