View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_26 (Length: 368)
Name: NF0714_low_26
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_26 |
 |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 165; Significance: 4e-88; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 88 - 310
Target Start/End: Complemental strand, 22616 - 22394
Alignment:
| Q |
88 |
catcatcatagtgatggtaaataaaatccctatataaaatgtaaatagtttgacctagaccaatcacatagtttcatagcaagaaatcctnnnnnnnnng |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22616 |
catcatcatagtgatggtaaataaaatccctatataaaatgtaaatagttggacctagaccaatcacatagtttcatagcaagaaatcctaaaaaaaaaa |
22517 |
T |
 |
| Q |
188 |
-gtaaataaacatcctctatttatcacctggttttcatggacctccttgttggatcaggaggttcccaaactttccatgaggatatagcttcctcttgta |
286 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22516 |
agtaaa-aaacatcctctatttttcacctggttttcatggacctccttgttcgatcaggaggttcccaaactttccatgaggatatagcttcctcttgta |
22418 |
T |
 |
| Q |
287 |
catgactttgaatttttgtctctg |
310 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22417 |
catgactttgaatttttgtctctg |
22394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University