View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0714_low_28 (Length: 360)
Name: NF0714_low_28
Description: NF0714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0714_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 348
Target Start/End: Complemental strand, 10079074 - 10078745
Alignment:
| Q |
19 |
ggacatcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcggcttcaccagaaacagatgcctgctgttgttgcatggaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10079074 |
ggacatcatcatgtcgtgaattattttctggaccgagttctgagcatcattactagggtcagcttcaccagaaacagatgcctgctgttgttgcatggaa |
10078975 |
T |
 |
| Q |
119 |
atattagctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgtgggttgttgttagatgaggacggtgttggtgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10078974 |
atattagctggtgagtttactgtacccatgtgatttgcagatgttaagccagggtgagaagtttgcgggttgttgttagatgaggacggtgttggtgaat |
10078875 |
T |
 |
| Q |
219 |
gaaaaggggacgagtttggttgtgcctgtggcactgtaccgcatgaacctggggatggaatatgagctgaactacctccatatggactgcttgcattgtt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078874 |
gaaaaggggacgagtttggttgtgcctgtggcactgtactgcatgaacctggggatggaatatgagctgaactacctccatatggactgcttgcattgtt |
10078775 |
T |
 |
| Q |
319 |
cattgaattttgctgtctagcgttcataga |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10078774 |
cattgaattttgctgtctagcgttcataga |
10078745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 179 - 330
Target Start/End: Original strand, 40776005 - 40776159
Alignment:
| Q |
179 |
gtttgtgggttgttgttagatgaggacggtgt---tggtgaatgaaaaggggacgagtttggttgtgcctgtggcactgtaccgcatgaacctggggatg |
275 |
Q |
| |
|
||||||||| ||| ||||||||||| ||||| |||||| ||||||||||| |||||||| || ||||||||||| |||| | | ||||| ||||||| |
|
|
| T |
40776005 |
gtttgtggggggttattagatgaggatggtgtaggtggtgactgaaaaggggatgagtttggctgggcctgtggcacagtactggaggaaccaggggatg |
40776104 |
T |
 |
| Q |
276 |
gaatatgagctgaactacctccatatggactgcttgcattgttcattgaattttg |
330 |
Q |
| |
|
|||| ||| | ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40776105 |
gaatctgaacagaattacctccatatggactgcttgcattgttcattgaattttg |
40776159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University